Incidental Mutation 'R5290:Wdr25'
ID424673
Institutional Source Beutler Lab
Gene Symbol Wdr25
Ensembl Gene ENSMUSG00000040877
Gene NameWD repeat domain 25
Synonyms
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108893631-109028452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108898042 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 38 (S38P)
Ref Sequence ENSEMBL: ENSMUSP00000152858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047115] [ENSMUST00000109848] [ENSMUST00000160477] [ENSMUST00000161154] [ENSMUST00000161410] [ENSMUST00000162748] [ENSMUST00000167816] [ENSMUST00000220495] [ENSMUST00000220667] [ENSMUST00000221377]
Predicted Effect probably benign
Transcript: ENSMUST00000047115
AA Change: S38P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035553
Gene: ENSMUSG00000040877
AA Change: S38P

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109848
SMART Domains Protein: ENSMUSP00000105474
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160477
Predicted Effect probably benign
Transcript: ENSMUST00000161154
SMART Domains Protein: ENSMUSP00000124625
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 446 1.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161410
SMART Domains Protein: ENSMUSP00000125320
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
WHEP-TRS 16 72 3.01e-23 SMART
Pfam:tRNA-synt_1b 155 447 5.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162748
SMART Domains Protein: ENSMUSP00000125102
Gene: ENSMUSG00000021266

DomainStartEndE-ValueType
PDB:2QUK|A 4 37 1e-8 PDB
SCOP:d1fyja_ 14 37 8e-7 SMART
Blast:WHEP 16 37 3e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000167816
AA Change: S38P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129855
Gene: ENSMUSG00000040877
AA Change: S38P

DomainStartEndE-ValueType
low complexity region 120 132 N/A INTRINSIC
low complexity region 180 206 N/A INTRINSIC
WD40 226 268 1.83e-7 SMART
WD40 272 311 6.73e-6 SMART
WD40 312 353 2.58e-1 SMART
Blast:WD40 356 402 7e-11 BLAST
Blast:WD40 407 445 6e-8 BLAST
WD40 451 492 9.6e-2 SMART
WD40 495 535 3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220495
Predicted Effect probably benign
Transcript: ENSMUST00000220667
AA Change: S38P

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000221377
AA Change: S38P

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Wdr25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Wdr25 APN 12 109025027 missense possibly damaging 0.89
IGL02479:Wdr25 APN 12 108898601 missense probably benign
IGL02672:Wdr25 APN 12 108898081 nonsense probably null
IGL03329:Wdr25 APN 12 108898336 missense probably benign
R1061:Wdr25 UTSW 12 108992799 splice site probably null
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1402:Wdr25 UTSW 12 109026539 missense probably damaging 1.00
R1582:Wdr25 UTSW 12 108898054 missense possibly damaging 0.94
R1764:Wdr25 UTSW 12 109026438 nonsense probably null
R1954:Wdr25 UTSW 12 108898541 missense probably damaging 0.99
R2258:Wdr25 UTSW 12 108898174 missense possibly damaging 0.94
R3770:Wdr25 UTSW 12 108898420 missense probably damaging 0.97
R3803:Wdr25 UTSW 12 108898553 missense probably damaging 1.00
R3948:Wdr25 UTSW 12 109027282 missense probably benign 0.02
R4183:Wdr25 UTSW 12 109027331 missense probably benign 0.00
R5246:Wdr25 UTSW 12 109027456 missense probably benign 0.06
R5305:Wdr25 UTSW 12 109026440 missense probably damaging 1.00
R5813:Wdr25 UTSW 12 109027421 missense possibly damaging 0.47
R5942:Wdr25 UTSW 12 108898466 missense probably benign 0.00
R6386:Wdr25 UTSW 12 109025065 missense probably damaging 1.00
R7171:Wdr25 UTSW 12 109024996 missense probably damaging 0.98
R7449:Wdr25 UTSW 12 109026441 missense probably damaging 1.00
R7616:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7617:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7619:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7622:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
R7623:Wdr25 UTSW 12 108992893 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGACGTCTTTGAGCTTCAAGGG -3'
(R):5'- GTTCCTTTGAGGGCCACTGTAG -3'

Sequencing Primer
(F):5'- CTTTGAGCTTCAAGGGGACATCC -3'
(R):5'- GCCTCTGGCTGGGACAAGAC -3'
Posted On2016-08-04