Incidental Mutation 'R5290:Vmn2r108'
ID424684
Institutional Source Beutler Lab
Gene Symbol Vmn2r108
Ensembl Gene ENSMUSG00000091805
Gene Namevomeronasal 2, receptor 108
SynonymsEG627805
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location20462373-20481236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20471403 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 286 (R286L)
Ref Sequence ENSEMBL: ENSMUSP00000130373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167314]
Predicted Effect probably benign
Transcript: ENSMUST00000167314
AA Change: R286L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000130373
Gene: ENSMUSG00000091805
AA Change: R286L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 6e-33 PFAM
Pfam:NCD3G 510 563 9.2e-22 PFAM
Pfam:7tm_3 593 831 2.2e-51 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Smad2 C T 18: 76,262,724 P78L probably damaging Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Vmn2r108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Vmn2r108 APN 17 20462512 missense probably damaging 0.98
IGL01143:Vmn2r108 APN 17 20462465 missense possibly damaging 0.82
IGL01311:Vmn2r108 APN 17 20462677 nonsense probably null
IGL01411:Vmn2r108 APN 17 20471020 missense probably benign 0.01
IGL01414:Vmn2r108 APN 17 20471680 missense probably benign 0.00
IGL01536:Vmn2r108 APN 17 20463281 missense probably damaging 1.00
IGL01748:Vmn2r108 APN 17 20463214 missense probably benign 0.03
IGL01769:Vmn2r108 APN 17 20471018 missense probably benign 0.02
IGL02022:Vmn2r108 APN 17 20471725 missense possibly damaging 0.77
IGL02041:Vmn2r108 APN 17 20463136 missense probably damaging 1.00
IGL02049:Vmn2r108 APN 17 20471346 missense probably benign 0.00
IGL02344:Vmn2r108 APN 17 20469143 missense probably damaging 1.00
IGL02939:Vmn2r108 APN 17 20471283 missense probably benign 0.05
IGL03202:Vmn2r108 APN 17 20471057 nonsense probably null
PIT4498001:Vmn2r108 UTSW 17 20463017 missense probably damaging 1.00
R0112:Vmn2r108 UTSW 17 20471635 missense probably benign 0.07
R0505:Vmn2r108 UTSW 17 20462834 missense possibly damaging 0.77
R0833:Vmn2r108 UTSW 17 20471459 missense probably benign
R0836:Vmn2r108 UTSW 17 20471459 missense probably benign
R0943:Vmn2r108 UTSW 17 20471135 nonsense probably null
R1411:Vmn2r108 UTSW 17 20462845 missense probably damaging 0.98
R1442:Vmn2r108 UTSW 17 20472361 nonsense probably null
R1587:Vmn2r108 UTSW 17 20472121 missense probably damaging 1.00
R1751:Vmn2r108 UTSW 17 20462524 missense probably damaging 1.00
R1773:Vmn2r108 UTSW 17 20469073 missense probably damaging 1.00
R2021:Vmn2r108 UTSW 17 20470990 missense probably benign 0.00
R2159:Vmn2r108 UTSW 17 20469101 missense probably benign 0.41
R2224:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2226:Vmn2r108 UTSW 17 20481033 nonsense probably null
R2517:Vmn2r108 UTSW 17 20472315 missense probably damaging 1.00
R3710:Vmn2r108 UTSW 17 20462670 missense probably benign
R4470:Vmn2r108 UTSW 17 20462728 missense probably damaging 1.00
R4686:Vmn2r108 UTSW 17 20471374 missense probably damaging 0.99
R4729:Vmn2r108 UTSW 17 20472370 missense probably damaging 0.99
R4799:Vmn2r108 UTSW 17 20462629 missense probably damaging 1.00
R4993:Vmn2r108 UTSW 17 20481187 missense probably benign 0.04
R5088:Vmn2r108 UTSW 17 20470192 missense possibly damaging 0.46
R5213:Vmn2r108 UTSW 17 20471493 missense probably benign 0.00
R5289:Vmn2r108 UTSW 17 20471604 missense probably damaging 1.00
R5713:Vmn2r108 UTSW 17 20471028 missense probably damaging 1.00
R5753:Vmn2r108 UTSW 17 20462917 missense probably damaging 0.99
R5792:Vmn2r108 UTSW 17 20463136 missense probably damaging 0.99
R5798:Vmn2r108 UTSW 17 20472283 missense probably benign 0.39
R5897:Vmn2r108 UTSW 17 20471318 missense probably benign 0.01
R6018:Vmn2r108 UTSW 17 20463006 missense possibly damaging 0.83
R6093:Vmn2r108 UTSW 17 20481140 missense probably benign 0.00
R6156:Vmn2r108 UTSW 17 20472185 missense probably benign 0.03
R6199:Vmn2r108 UTSW 17 20462382 missense probably benign 0.01
R6259:Vmn2r108 UTSW 17 20463109 missense possibly damaging 0.95
R6309:Vmn2r108 UTSW 17 20471398 missense probably damaging 0.98
R6324:Vmn2r108 UTSW 17 20471715 nonsense probably null
R6364:Vmn2r108 UTSW 17 20470998 missense probably benign 0.00
R6446:Vmn2r108 UTSW 17 20472347 nonsense probably null
R6541:Vmn2r108 UTSW 17 20481218 missense probably benign 0.02
R7025:Vmn2r108 UTSW 17 20471083 missense possibly damaging 0.67
R7063:Vmn2r108 UTSW 17 20481148 missense probably damaging 1.00
R7092:Vmn2r108 UTSW 17 20481076 missense probably benign 0.10
R7096:Vmn2r108 UTSW 17 20462500 missense probably damaging 1.00
R7203:Vmn2r108 UTSW 17 20462776 missense probably benign 0.12
R7458:Vmn2r108 UTSW 17 20472270 missense probably benign 0.17
R7619:Vmn2r108 UTSW 17 20472195 missense probably benign 0.02
X0022:Vmn2r108 UTSW 17 20471109 missense probably damaging 1.00
Z1088:Vmn2r108 UTSW 17 20471113 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACAGTTAGCCAAAAGTCGAC -3'
(R):5'- GGTTGGTCTCATCCTTCCAG -3'

Sequencing Primer
(F):5'- GCCATAACTTAGGAAGGTAAATGTC -3'
(R):5'- GGTTGGTCTCATCCTTCCAGATAAC -3'
Posted On2016-08-04