Mutagenetix > Incidental Mutations

Incidental Mutation 'R5290:Greb1l'

424688

Institutional Source

Beutler Lab

Gene Symbol

Greb1l

Ensembl Gene

ENSMUSG00000042942

Gene Name

growth regulation by estrogen in breast cancer-like

Synonyms

AK220484, mKIAA4095

MMRRC Submission

042873-MU

Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5290 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10325177-10562934 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 10542427 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1341 (E1341K)

Ref Sequence

ENSEMBL: ENSMUSP00000049003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532] [ENSMUST00000172680]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048977
AA Change: E1341K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: E1341K

Domain	Start	End	E-Value	Type
Pfam:GREB1	1	1172	N/A	PFAM
Pfam:GREB1	1154	1913	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000172532

SMART Domains

Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	83	100	N/A	INTRINSIC
low complexity region	282	301	N/A	INTRINSIC
low complexity region	606	617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172680

SMART Domains

Protein: ENSMUSP00000134314
Gene: ENSMUSG00000042942

Domain	Start	End	E-Value	Type
low complexity region	116	129	N/A	INTRINSIC

Meta Mutation Damage Score

0.1179

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

97% (70/72)

Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008E08Rik	A	T	16: 90,554,210		noncoding transcript	Het
2700049A03Rik	C	A	12: 71,188,791	P1172T	probably benign	Het
Abi3bp	T	A	16: 56,642,475		probably null	Het
Apod	T	A	16: 31,311,066	H24L	probably damaging	Het
Arfgef3	T	C	10: 18,600,460	E1537G	probably damaging	Het
B020004C17Rik	T	C	14: 57,016,579	V53A	possibly damaging	Het
Ccdc113	C	A	8: 95,540,796		probably null	Het
Cd7	T	G	11: 121,038,110	D105A	probably damaging	Het
Celsr3	C	T	9: 108,843,158	T2550M	probably benign	Het
Col6a5	C	T	9: 105,946,083	G25D	unknown	Het
Cps1	A	G	1: 67,172,709	M679V	probably benign	Het
Dync1h1	A	T	12: 110,615,068	T316S	probably benign	Het
Edrf1	T	C	7: 133,650,566	Y449H	probably damaging	Het
Fam92a	T	C	4: 12,171,195	Q86R	probably benign	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
Flg2	A	T	3: 93,220,566	I2262L	unknown	Het
Flnc	T	C	6: 29,457,554	L2417P	probably damaging	Het
Gabrp	A	T	11: 33,567,310	Y121N	probably damaging	Het
Gdpd4	A	G	7: 97,966,336	T123A	possibly damaging	Het
Gm4763	T	C	7: 24,723,411	E79G	probably benign	Het
Gpr162	C	A	6: 124,861,269	M139I	probably benign	Het
Gsn	G	A	2: 35,296,472	S410N	probably benign	Het
Gtf2f2	T	C	14: 75,897,649	Y212C	probably damaging	Het
Hao2	C	T	3: 98,877,177	A291T	probably damaging	Het
Igkv1-133	A	G	6: 67,725,579	T94A	possibly damaging	Het
Irf2bp1	G	A	7: 19,004,998	A188T	possibly damaging	Het
Itpr1	T	C	6: 108,406,145	V1478A	possibly damaging	Het
Kdm5b	T	C	1: 134,622,099		probably null	Het
Kif5b	A	T	18: 6,234,882	D49E	probably damaging	Het
Lmbr1l	A	G	15: 98,912,242	W113R	probably damaging	Het
Lrp2	T	C	2: 69,513,354	D887G	probably damaging	Het
Lrrc14	T	A	15: 76,713,943	M291K	probably benign	Het
Mgarp	G	A	3: 51,388,966	A205V	possibly damaging	Het
Msl2	T	C	9: 101,101,407		probably null	Het
Nfix	G	A	8: 84,713,777	Q487*	probably null	Het
Notch4	T	C	17: 34,565,289	V22A	probably benign	Het
Npc1l1	T	A	11: 6,222,221	Q823L	probably benign	Het
Obox3	T	C	7: 15,626,849	K122E	probably benign	Het
Olfr282	T	C	15: 98,438,332	Y288H	probably damaging	Het
Olfr446	A	G	6: 42,928,038	K269R	probably damaging	Het
Olfr509	C	T	7: 108,646,548	M9I	probably benign	Het
Plekhh3	T	A	11: 101,166,571	M287L	possibly damaging	Het
Prpf3	A	T	3: 95,853,545	I15K	probably benign	Het
Rpl12-ps1	G	T	1: 36,958,342		noncoding transcript	Het
Rps8	G	C	4: 117,155,155		probably benign	Het
Setd2	T	C	9: 110,617,831	V2489A	probably damaging	Het
Slfn10-ps	T	A	11: 83,029,025		noncoding transcript	Het
Smad2	C	T	18: 76,262,724	P78L	probably damaging	Het
Spen	G	A	4: 141,473,816	T2500I	probably damaging	Het
Stmnd1	A	G	13: 46,299,598	D250G	probably benign	Het
Tjp2	T	G	19: 24,131,204	E181D	probably benign	Het
Tmem131l	T	C	3: 83,899,265	D1478G	probably benign	Het
Trim72	G	T	7: 128,010,004	R326L	probably benign	Het
Ttn	A	T	2: 76,897,240		probably benign	Het
Vmn1r177	A	T	7: 23,866,073	M126K	probably damaging	Het
Vmn1r57	A	G	7: 5,221,320	I281M	probably damaging	Het
Vmn2r108	C	A	17: 20,471,403	R286L	probably benign	Het
Wdr25	T	C	12: 108,898,042	S38P	probably benign	Het
Wdr78	A	T	4: 103,049,533	D694E	probably benign	Het
Zfp937	T	A	2: 150,238,309	Y86*	probably null	Het
Zfr2	CTCAGACTGGTGTCAGAC	CTCAGAC	10: 81,246,710		probably null	Het
Zswim1	C	T	2: 164,825,925	H366Y	probably damaging	Het

Other mutations in Greb1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Greb1l	APN	18	10555962	missense	possibly damaging	0.90
IGL01554:Greb1l	APN	18	10522144	missense	probably benign	0.01
IGL01563:Greb1l	APN	18	10469399	missense	probably damaging	0.99
IGL01944:Greb1l	APN	18	10557280	missense	possibly damaging	0.91
IGL02110:Greb1l	APN	18	10515271	missense	probably damaging	1.00
IGL02249:Greb1l	APN	18	10532961	missense	probably damaging	1.00
IGL02318:Greb1l	APN	18	10469388	missense	possibly damaging	0.91
IGL02340:Greb1l	APN	18	10515200	missense	probably damaging	0.99
IGL02516:Greb1l	APN	18	10537064	missense	probably benign	0.31
IGL02566:Greb1l	APN	18	10503299	missense	probably damaging	0.99
IGL02583:Greb1l	APN	18	10542362	missense	probably damaging	1.00
IGL02838:Greb1l	APN	18	10560430	missense	probably damaging	1.00
A4554:Greb1l	UTSW	18	10532862	missense	possibly damaging	0.58
PIT4453001:Greb1l	UTSW	18	10533031	missense	probably damaging	0.98
PIT4453001:Greb1l	UTSW	18	10533032	missense	probably benign	0.08
R0099:Greb1l	UTSW	18	10509158	missense	probably damaging	1.00
R0226:Greb1l	UTSW	18	10522076	intron	probably benign
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0234:Greb1l	UTSW	18	10560331	missense	probably damaging	1.00
R0239:Greb1l	UTSW	18	10458567	splice site	probably benign
R0316:Greb1l	UTSW	18	10547420	missense	probably damaging	1.00
R0369:Greb1l	UTSW	18	10469375	missense	possibly damaging	0.80
R0394:Greb1l	UTSW	18	10523374	missense	probably damaging	0.99
R0478:Greb1l	UTSW	18	10509281	missense	probably damaging	1.00
R0555:Greb1l	UTSW	18	10458781	splice site	probably benign
R0671:Greb1l	UTSW	18	10474303	missense	probably damaging	1.00
R1282:Greb1l	UTSW	18	10547289	missense	probably benign	0.13
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1574:Greb1l	UTSW	18	10554997	missense	possibly damaging	0.95
R1607:Greb1l	UTSW	18	10529703	missense	possibly damaging	0.85
R1666:Greb1l	UTSW	18	10501080	critical splice donor site	probably null
R1666:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R1720:Greb1l	UTSW	18	10553848	missense	probably benign	0.19
R1808:Greb1l	UTSW	18	10542143	missense	probably benign
R1829:Greb1l	UTSW	18	10509314	missense	probably damaging	1.00
R1897:Greb1l	UTSW	18	10498992	missense	probably benign	0.00
R1967:Greb1l	UTSW	18	10501049	missense	possibly damaging	0.91
R2025:Greb1l	UTSW	18	10515221	missense	possibly damaging	0.71
R2086:Greb1l	UTSW	18	10523281	missense	probably damaging	1.00
R2125:Greb1l	UTSW	18	10511422	missense	probably damaging	0.98
R2139:Greb1l	UTSW	18	10555011	missense	probably damaging	1.00
R2255:Greb1l	UTSW	18	10554857	missense	probably damaging	1.00
R2256:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2257:Greb1l	UTSW	18	10503307	missense	possibly damaging	0.91
R2880:Greb1l	UTSW	18	10547288	missense	possibly damaging	0.93
R3623:Greb1l	UTSW	18	10542380	missense	probably damaging	0.99
R3778:Greb1l	UTSW	18	10469444	missense	possibly damaging	0.60
R3975:Greb1l	UTSW	18	10522247	missense	possibly damaging	0.71
R4038:Greb1l	UTSW	18	10515209	missense	possibly damaging	0.93
R4062:Greb1l	UTSW	18	10522150	missense	probably damaging	0.99
R4134:Greb1l	UTSW	18	10529708	critical splice donor site	probably null
R4342:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R4409:Greb1l	UTSW	18	10503182	missense	possibly damaging	0.70
R4600:Greb1l	UTSW	18	10553705	missense	probably damaging	1.00
R4618:Greb1l	UTSW	18	10498965	missense	probably benign	0.00
R4683:Greb1l	UTSW	18	10529563	splice site	probably null
R4686:Greb1l	UTSW	18	10522112	missense	probably damaging	0.98
R4707:Greb1l	UTSW	18	10532922	missense	probably benign	0.02
R4780:Greb1l	UTSW	18	10541792	missense	probably benign	0.00
R4819:Greb1l	UTSW	18	10458358	missense	probably damaging	1.00
R4925:Greb1l	UTSW	18	10547447	missense	possibly damaging	0.79
R4960:Greb1l	UTSW	18	10547306	missense	probably damaging	0.99
R5150:Greb1l	UTSW	18	10555950	frame shift	probably null
R5154:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5269:Greb1l	UTSW	18	10511409	missense	probably benign
R5310:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5328:Greb1l	UTSW	18	10553720	missense	probably damaging	1.00
R5337:Greb1l	UTSW	18	10509143	missense	probably damaging	1.00
R5393:Greb1l	UTSW	18	10458312	missense	probably benign	0.02
R5402:Greb1l	UTSW	18	10537169	missense	probably benign	0.26
R5718:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5719:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5720:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5721:Greb1l	UTSW	18	10542427	missense	probably damaging	1.00
R5902:Greb1l	UTSW	18	10538302	missense	probably benign	0.00
R5993:Greb1l	UTSW	18	10544455	missense	probably benign	0.10
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6035:Greb1l	UTSW	18	10501025	missense	possibly damaging	0.91
R6045:Greb1l	UTSW	18	10547068	missense	probably damaging	1.00
R6063:Greb1l	UTSW	18	10557340	missense	probably damaging	1.00
R6297:Greb1l	UTSW	18	10469494	missense	probably damaging	1.00
R6405:Greb1l	UTSW	18	10501076	missense	probably benign	0.30
R6552:Greb1l	UTSW	18	10541814	missense	probably benign	0.00
R6572:Greb1l	UTSW	18	10522131	missense	probably benign	0.07
R6575:Greb1l	UTSW	18	10547347	missense	possibly damaging	0.88
R6922:Greb1l	UTSW	18	10547482	missense	possibly damaging	0.88
R6957:Greb1l	UTSW	18	10558786	missense	probably benign	0.23
R6962:Greb1l	UTSW	18	10547327	missense	probably damaging	1.00
R7012:Greb1l	UTSW	18	10529707	critical splice donor site	probably null
R7179:Greb1l	UTSW	18	10544576	missense	probably benign	0.00
R7251:Greb1l	UTSW	18	10515319	missense	probably damaging	1.00
R7275:Greb1l	UTSW	18	10544561	missense	probably benign	0.12
R7301:Greb1l	UTSW	18	10544970	missense	probably damaging	1.00
R7307:Greb1l	UTSW	18	10538142	missense	probably damaging	0.99
R7455:Greb1l	UTSW	18	10554915	missense	probably damaging	1.00
R7832:Greb1l	UTSW	18	10542056	missense	probably benign	0.38
R7934:Greb1l	UTSW	18	10474371	nonsense	probably null
R8137:Greb1l	UTSW	18	10474357	missense	possibly damaging	0.77
R8138:Greb1l	UTSW	18	10533060	missense	probably benign	0.13
R8208:Greb1l	UTSW	18	10510703	missense	probably damaging	1.00
R8227:Greb1l	UTSW	18	10515371	missense	probably damaging	1.00
R8312:Greb1l	UTSW	18	10511587	intron	probably benign
R8331:Greb1l	UTSW	18	10458706	missense	possibly damaging	0.96
R8364:Greb1l	UTSW	18	10529687	missense	possibly damaging	0.85
R8389:Greb1l	UTSW	18	10529613	missense	probably benign	0.00
R8695:Greb1l	UTSW	18	10544450	missense	probably benign	0.01
R8795:Greb1l	UTSW	18	10553739	missense	probably damaging	0.98
R8836:Greb1l	UTSW	18	10509257	missense	probably benign	0.30
R8862:Greb1l	UTSW	18	10555042	missense	possibly damaging	0.90
R8872:Greb1l	UTSW	18	10529684	missense	probably benign	0.18
R8874:Greb1l	UTSW	18	10544896	missense	probably benign	0.01
Z1176:Greb1l	UTSW	18	10515305	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCAGAAGACCTCTCAGACCTTAG -3'
(R):5'- AGGCAGTGAACCTACCTACC -3'

Sequencing Primer
(F):5'- TCTCAGACCTTAGCTGAAGAGC -3'
(R):5'- TGACACACAGCTTGCTGC -3'

Posted On

2016-08-04