Incidental Mutation 'R5290:Smad2'
ID424689
Institutional Source Beutler Lab
Gene Symbol Smad2
Ensembl Gene ENSMUSG00000024563
Gene NameSMAD family member 2
SynonymsSmad 2, Madr2, 7120426M23Rik, Madh2
MMRRC Submission 042873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5290 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location76241580-76305731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76262724 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 78 (P78L)
Ref Sequence ENSEMBL: ENSMUSP00000130115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]
Predicted Effect probably damaging
Transcript: ENSMUST00000025453
AA Change: P78L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: P78L

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000091831
AA Change: P78L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: P78L

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 1e-10 BLAST
DWB 242 413 2.25e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113930
AA Change: P78L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: P78L

DomainStartEndE-ValueType
DWA 36 144 1.68e-66 SMART
Blast:DWB 200 231 9e-11 BLAST
DWB 242 408 4.38e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000165084
AA Change: P78L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563
AA Change: P78L

DomainStartEndE-ValueType
DWA 36 144 7.85e-67 SMART
PDB:1KHX|A 166 204 3e-19 PDB
SCOP:d1khxa_ 190 204 7e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168423
AA Change: P78L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: P78L

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWB 230 261 2e-10 BLAST
DWB 272 443 2.25e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171256
AA Change: P78L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: P78L

DomainStartEndE-ValueType
DWA 36 174 1e-64 SMART
Blast:DWA 182 213 3e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172198
SMART Domains Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

DomainStartEndE-ValueType
Pfam:MH2 28 58 1.8e-10 PFAM
Meta Mutation Damage Score 0.8641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 97% (70/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008E08Rik A T 16: 90,554,210 noncoding transcript Het
2700049A03Rik C A 12: 71,188,791 P1172T probably benign Het
Abi3bp T A 16: 56,642,475 probably null Het
Apod T A 16: 31,311,066 H24L probably damaging Het
Arfgef3 T C 10: 18,600,460 E1537G probably damaging Het
B020004C17Rik T C 14: 57,016,579 V53A possibly damaging Het
Ccdc113 C A 8: 95,540,796 probably null Het
Cd7 T G 11: 121,038,110 D105A probably damaging Het
Celsr3 C T 9: 108,843,158 T2550M probably benign Het
Col6a5 C T 9: 105,946,083 G25D unknown Het
Cps1 A G 1: 67,172,709 M679V probably benign Het
Dync1h1 A T 12: 110,615,068 T316S probably benign Het
Edrf1 T C 7: 133,650,566 Y449H probably damaging Het
Fam92a T C 4: 12,171,195 Q86R probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flg2 A T 3: 93,220,566 I2262L unknown Het
Flnc T C 6: 29,457,554 L2417P probably damaging Het
Gabrp A T 11: 33,567,310 Y121N probably damaging Het
Gdpd4 A G 7: 97,966,336 T123A possibly damaging Het
Gm4763 T C 7: 24,723,411 E79G probably benign Het
Gpr162 C A 6: 124,861,269 M139I probably benign Het
Greb1l G A 18: 10,542,427 E1341K probably damaging Het
Gsn G A 2: 35,296,472 S410N probably benign Het
Gtf2f2 T C 14: 75,897,649 Y212C probably damaging Het
Hao2 C T 3: 98,877,177 A291T probably damaging Het
Igkv1-133 A G 6: 67,725,579 T94A possibly damaging Het
Irf2bp1 G A 7: 19,004,998 A188T possibly damaging Het
Itpr1 T C 6: 108,406,145 V1478A possibly damaging Het
Kdm5b T C 1: 134,622,099 probably null Het
Kif5b A T 18: 6,234,882 D49E probably damaging Het
Lmbr1l A G 15: 98,912,242 W113R probably damaging Het
Lrp2 T C 2: 69,513,354 D887G probably damaging Het
Lrrc14 T A 15: 76,713,943 M291K probably benign Het
Mgarp G A 3: 51,388,966 A205V possibly damaging Het
Msl2 T C 9: 101,101,407 probably null Het
Nfix G A 8: 84,713,777 Q487* probably null Het
Notch4 T C 17: 34,565,289 V22A probably benign Het
Npc1l1 T A 11: 6,222,221 Q823L probably benign Het
Obox3 T C 7: 15,626,849 K122E probably benign Het
Olfr282 T C 15: 98,438,332 Y288H probably damaging Het
Olfr446 A G 6: 42,928,038 K269R probably damaging Het
Olfr509 C T 7: 108,646,548 M9I probably benign Het
Plekhh3 T A 11: 101,166,571 M287L possibly damaging Het
Prpf3 A T 3: 95,853,545 I15K probably benign Het
Rpl12-ps1 G T 1: 36,958,342 noncoding transcript Het
Rps8 G C 4: 117,155,155 probably benign Het
Setd2 T C 9: 110,617,831 V2489A probably damaging Het
Slfn10-ps T A 11: 83,029,025 noncoding transcript Het
Spen G A 4: 141,473,816 T2500I probably damaging Het
Stmnd1 A G 13: 46,299,598 D250G probably benign Het
Tjp2 T G 19: 24,131,204 E181D probably benign Het
Tmem131l T C 3: 83,899,265 D1478G probably benign Het
Trim72 G T 7: 128,010,004 R326L probably benign Het
Ttn A T 2: 76,897,240 probably benign Het
Vmn1r177 A T 7: 23,866,073 M126K probably damaging Het
Vmn1r57 A G 7: 5,221,320 I281M probably damaging Het
Vmn2r108 C A 17: 20,471,403 R286L probably benign Het
Wdr25 T C 12: 108,898,042 S38P probably benign Het
Wdr78 A T 4: 103,049,533 D694E probably benign Het
Zfp937 T A 2: 150,238,309 Y86* probably null Het
Zfr2 CTCAGACTGGTGTCAGAC CTCAGAC 10: 81,246,710 probably null Het
Zswim1 C T 2: 164,825,925 H366Y probably damaging Het
Other mutations in Smad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Smad2 APN 18 76298495 missense possibly damaging 0.94
IGL00978:Smad2 APN 18 76299775 splice site probably benign
IGL01295:Smad2 APN 18 76302430 missense probably benign 0.05
IGL01887:Smad2 APN 18 76299894 missense probably damaging 1.00
IGL01960:Smad2 APN 18 76262484 intron probably benign
IGL02881:Smad2 APN 18 76299780 splice site probably null
IGL02977:Smad2 APN 18 76289164 missense possibly damaging 0.64
R0333:Smad2 UTSW 18 76262621 missense probably damaging 1.00
R0391:Smad2 UTSW 18 76289037 critical splice acceptor site probably null
R0523:Smad2 UTSW 18 76262552 missense probably benign
R0570:Smad2 UTSW 18 76289179 splice site probably benign
R0624:Smad2 UTSW 18 76299993 missense probably damaging 1.00
R1573:Smad2 UTSW 18 76262586 missense possibly damaging 0.89
R1953:Smad2 UTSW 18 76262705 missense possibly damaging 0.90
R2132:Smad2 UTSW 18 76288084 nonsense probably null
R2213:Smad2 UTSW 18 76304626 missense probably damaging 1.00
R3021:Smad2 UTSW 18 76262632 missense probably damaging 1.00
R3917:Smad2 UTSW 18 76287937 missense probably benign 0.42
R4503:Smad2 UTSW 18 76302592 missense probably benign 0.23
R5253:Smad2 UTSW 18 76288053 missense probably damaging 1.00
R5891:Smad2 UTSW 18 76299975 missense probably damaging 1.00
R6294:Smad2 UTSW 18 76289162 missense probably benign 0.31
R6879:Smad2 UTSW 18 76262654 missense possibly damaging 0.49
R7430:Smad2 UTSW 18 76288080 missense probably damaging 1.00
R7503:Smad2 UTSW 18 76286885 missense probably benign
R7757:Smad2 UTSW 18 76288013 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAAATCAGCCGGTGGGTCTG -3'
(R):5'- AAACTACTAGCCAGCACTTGTC -3'

Sequencing Primer
(F):5'- TCTGGAGGAGCAGGTGG -3'
(R):5'- AGCCAGCACTTGTCAGCTATTTG -3'
Posted On2016-08-04