Incidental Mutation 'R5381:Nlrp4b'
ID424712
Institutional Source Beutler Lab
Gene Symbol Nlrp4b
Ensembl Gene ENSMUSG00000034087
Gene NameNLR family, pyrin domain containing 4B
SynonymsNalp4b, Nalp-gamma
MMRRC Submission 042956-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R5381 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10687789-10730168 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 10715245 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 91 (Y91*)
Ref Sequence ENSEMBL: ENSMUSP00000115831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047809] [ENSMUST00000117413] [ENSMUST00000132990] [ENSMUST00000211069]
Predicted Effect probably null
Transcript: ENSMUST00000047809
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000043881
Gene: ENSMUSG00000034087
AA Change: Y458*

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 7.9e-40 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000117413
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000113095
Gene: ENSMUSG00000034087
AA Change: Y458*

DomainStartEndE-ValueType
PYRIN 6 89 1.4e-20 SMART
Pfam:NACHT 143 312 3.3e-39 PFAM
low complexity region 520 535 N/A INTRINSIC
LRR 683 710 4.9e0 SMART
LRR 712 739 1.97e0 SMART
LRR 740 767 1.13e-4 SMART
LRR 769 796 1.93e1 SMART
LRR 797 824 1.73e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000132990
AA Change: Y91*
SMART Domains Protein: ENSMUSP00000115831
Gene: ENSMUSG00000034087
AA Change: Y91*

DomainStartEndE-ValueType
low complexity region 153 168 N/A INTRINSIC
LRR 316 343 4.9e0 SMART
LRR 345 372 1.97e0 SMART
LRR 373 400 1.13e-4 SMART
LRR 402 429 1.93e1 SMART
LRR 430 457 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000211069
Predicted Effect probably benign
Transcript: ENSMUST00000211258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211772
Meta Mutation Damage Score 0.9698 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,232,907 D185G probably damaging Het
1700086D15Rik G T 11: 65,153,311 S19* probably null Het
4930432E11Rik A T 7: 29,562,968 noncoding transcript Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Ankmy1 T C 1: 92,876,562 T900A probably benign Het
Anp32a A C 9: 62,372,177 E107A probably damaging Het
Arhgef40 T C 14: 51,991,849 I623T probably damaging Het
Camsap3 T A 8: 3,603,812 I483N probably damaging Het
Card9 G A 2: 26,358,883 L85F probably damaging Het
Cbfa2t2 T G 2: 154,523,929 V353G probably damaging Het
Ccdc166 A T 15: 75,980,852 L422* probably null Het
Ccdc73 A T 2: 104,989,925 N416Y probably damaging Het
Celsr2 A T 3: 108,402,757 D1552E probably damaging Het
Ces1b A T 8: 93,065,019 N317K probably benign Het
Col6a3 T C 1: 90,775,612 R2471G unknown Het
Crocc C T 4: 141,029,311 R1165H possibly damaging Het
Csmd3 T A 15: 47,741,215 Y1955F probably benign Het
Ctbp1 A T 5: 33,249,690 D232E probably benign Het
Cuedc1 T A 11: 88,187,986 probably null Het
Dctd C T 8: 48,137,414 probably benign Het
Dusp6 G A 10: 99,266,267 V226I possibly damaging Het
Gpr152 A G 19: 4,142,517 E19G probably damaging Het
Ighv16-1 T C 12: 114,068,973 T70A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Il12b C A 11: 44,407,872 D51E possibly damaging Het
Il9r T G 11: 32,190,715 D435A probably benign Het
Jakmip2 T C 18: 43,581,960 D167G probably damaging Het
Klrd1 A G 6: 129,595,434 D63G possibly damaging Het
Lactb A G 9: 66,956,015 L439P probably damaging Het
Laptm5 T C 4: 130,933,658 probably benign Het
Lgals1 A G 15: 78,930,023 D96G probably benign Het
Lrp8 A T 4: 107,869,110 H871L probably damaging Het
Mfap4 A T 11: 61,487,930 I235F probably benign Het
Muc6 G A 7: 141,637,923 T2279I possibly damaging Het
Osbp2 A G 11: 3,705,593 Y383H probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Palb2 G T 7: 122,128,413 T78K probably benign Het
Panx2 G T 15: 89,060,230 V53L probably damaging Het
Pitx1 T C 13: 55,826,079 Y313C probably damaging Het
Pjvk A G 2: 76,651,560 probably null Het
Pnldc1 T G 17: 12,890,396 K439T probably benign Het
Ppp4r4 A C 12: 103,593,098 T513P probably benign Het
Pram1 A T 17: 33,641,626 Q389L probably damaging Het
Prg4 T C 1: 150,454,453 probably benign Het
Prkch C A 12: 73,691,592 R158S probably damaging Het
Ptpn7 A T 1: 135,143,168 M332L probably damaging Het
Rad51c A T 11: 87,397,633 D241E probably benign Het
Rara T G 11: 98,971,584 I270M possibly damaging Het
Ryr2 T A 13: 11,556,658 D4898V probably damaging Het
Sec31b C T 19: 44,534,371 G218S probably damaging Het
Slc9a1 T A 4: 133,422,071 L736Q probably damaging Het
Slco2a1 A T 9: 103,068,014 D196V probably damaging Het
Sp3 C A 2: 72,970,566 A368S probably benign Het
Stk24 A T 14: 121,294,233 L337Q possibly damaging Het
Tbc1d13 A G 2: 30,137,367 T96A probably benign Het
Tm2d3 G A 7: 65,701,672 G225S probably damaging Het
Tmem55b T C 14: 50,929,038 E161G probably benign Het
Urb2 T C 8: 124,029,912 V786A probably benign Het
Usp32 C T 11: 85,059,127 probably benign Het
Usp54 C T 14: 20,586,076 G300D probably damaging Het
Vmn1r124 T A 7: 21,260,398 N74Y probably damaging Het
Vmn1r77 T A 7: 12,042,025 C175S probably damaging Het
Vmn2r62 G T 7: 42,787,795 Q422K probably benign Het
Vmn2r76 A G 7: 86,225,288 F827S probably damaging Het
Vps52 A G 17: 33,958,301 S106G possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zic2 A G 14: 122,475,815 N47S probably damaging Het
Other mutations in Nlrp4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Nlrp4b APN 7 10714955 missense possibly damaging 0.68
IGL01456:Nlrp4b APN 7 10714223 missense probably benign 0.26
IGL01537:Nlrp4b APN 7 10714991 missense probably damaging 1.00
IGL02539:Nlrp4b APN 7 10714428 missense probably damaging 0.96
IGL02730:Nlrp4b APN 7 10714758 missense probably damaging 1.00
IGL02871:Nlrp4b APN 7 10715265 missense probably benign 0.26
IGL03008:Nlrp4b APN 7 10714589 missense probably benign 0.00
IGL03109:Nlrp4b APN 7 10714946 missense probably damaging 1.00
IGL03251:Nlrp4b APN 7 10714500 missense probably benign 0.01
IGL03354:Nlrp4b APN 7 10714538 missense probably damaging 0.99
R0052:Nlrp4b UTSW 7 10725962 nonsense probably null
R0348:Nlrp4b UTSW 7 10715181 missense possibly damaging 0.60
R0564:Nlrp4b UTSW 7 10714658 missense probably benign 0.15
R0573:Nlrp4b UTSW 7 10714215 missense probably benign 0.01
R0581:Nlrp4b UTSW 7 10714530 missense probably damaging 1.00
R1201:Nlrp4b UTSW 7 10715436 missense possibly damaging 0.64
R1541:Nlrp4b UTSW 7 10725052 missense possibly damaging 0.91
R1771:Nlrp4b UTSW 7 10718593 missense probably damaging 0.96
R1781:Nlrp4b UTSW 7 10715339 missense probably benign 0.13
R1833:Nlrp4b UTSW 7 10725936 missense probably benign 0.00
R2405:Nlrp4b UTSW 7 10714728 missense probably benign 0.08
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2871:Nlrp4b UTSW 7 10710243 nonsense probably null
R2873:Nlrp4b UTSW 7 10710243 nonsense probably null
R2904:Nlrp4b UTSW 7 10714367 missense probably damaging 1.00
R3410:Nlrp4b UTSW 7 10715529 missense probably damaging 1.00
R3714:Nlrp4b UTSW 7 10714881 missense probably benign 0.04
R3982:Nlrp4b UTSW 7 10714431 missense possibly damaging 0.95
R4668:Nlrp4b UTSW 7 10714733 missense possibly damaging 0.66
R4690:Nlrp4b UTSW 7 10719203 missense probably benign 0.00
R4857:Nlrp4b UTSW 7 10715298 missense probably benign 0.05
R5247:Nlrp4b UTSW 7 10714218 missense probably benign 0.21
R5529:Nlrp4b UTSW 7 10714946 missense possibly damaging 0.91
R5589:Nlrp4b UTSW 7 10715585 missense probably benign 0.34
R5770:Nlrp4b UTSW 7 10715487 missense probably benign 0.00
R5990:Nlrp4b UTSW 7 10714491 missense possibly damaging 0.61
R6049:Nlrp4b UTSW 7 10714713 nonsense probably null
R6329:Nlrp4b UTSW 7 10724920 missense probably benign 0.16
R6377:Nlrp4b UTSW 7 10715412 missense probably benign 0.00
R7107:Nlrp4b UTSW 7 10715217 missense probably damaging 0.96
R7209:Nlrp4b UTSW 7 10710370 missense probably benign 0.01
R7237:Nlrp4b UTSW 7 10715216 missense probably benign 0.12
R7537:Nlrp4b UTSW 7 10714889 missense probably benign 0.05
R7793:Nlrp4b UTSW 7 10725074 missense probably benign 0.00
X0063:Nlrp4b UTSW 7 10729587 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGCATGTGGACTGATATATC -3'
(R):5'- TCCAATAGGAGTTCCAGCCAC -3'

Sequencing Primer
(F):5'- CTGTGTTTAATGAGGAGGCTCTAAG -3'
(R):5'- GTCGCCTTAATTCTTTAGATAAGTGG -3'
Posted On2016-08-04