Incidental Mutation 'R5381:Usp32'
ID 424738
Institutional Source Beutler Lab
Gene Symbol Usp32
Ensembl Gene ENSMUSG00000000804
Gene Name ubiquitin specific peptidase 32
Synonyms 6430526O11Rik, 2900074J03Rik
MMRRC Submission 042956-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5381 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 84984442-85140161 bp(-) (GRCm38)
Type of Mutation critical splice donor site
DNA Base Change (assembly) C to T at 85059127 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108075]
AlphaFold F8VPZ3
Predicted Effect probably benign
Transcript: ENSMUST00000108075
SMART Domains Protein: ENSMUSP00000103710
Gene: ENSMUSG00000000804

DomainStartEndE-ValueType
EFh 232 260 4.66e0 SMART
EFh 268 296 5.8e-1 SMART
Blast:EFh 318 346 5e-7 BLAST
DUSP 389 588 2.32e-16 SMART
Pfam:Ubiquitin_3 628 711 2.4e-9 PFAM
Pfam:UCH 733 1564 2.4e-83 PFAM
Pfam:UCH_1 1202 1547 2.9e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (74/74)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,232,907 D185G probably damaging Het
1700086D15Rik G T 11: 65,153,311 S19* probably null Het
4930432E11Rik A T 7: 29,562,968 noncoding transcript Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Ankmy1 T C 1: 92,876,562 T900A probably benign Het
Anp32a A C 9: 62,372,177 E107A probably damaging Het
Arhgef40 T C 14: 51,991,849 I623T probably damaging Het
Camsap3 T A 8: 3,603,812 I483N probably damaging Het
Card9 G A 2: 26,358,883 L85F probably damaging Het
Cbfa2t2 T G 2: 154,523,929 V353G probably damaging Het
Ccdc166 A T 15: 75,980,852 L422* probably null Het
Ccdc73 A T 2: 104,989,925 N416Y probably damaging Het
Celsr2 A T 3: 108,402,757 D1552E probably damaging Het
Ces1b A T 8: 93,065,019 N317K probably benign Het
Col6a3 T C 1: 90,775,612 R2471G unknown Het
Crocc C T 4: 141,029,311 R1165H possibly damaging Het
Csmd3 T A 15: 47,741,215 Y1955F probably benign Het
Ctbp1 A T 5: 33,249,690 D232E probably benign Het
Cuedc1 T A 11: 88,187,986 probably null Het
Dctd C T 8: 48,137,414 probably benign Het
Dusp6 G A 10: 99,266,267 V226I possibly damaging Het
Gpr152 A G 19: 4,142,517 E19G probably damaging Het
Ighv16-1 T C 12: 114,068,973 T70A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Il12b C A 11: 44,407,872 D51E possibly damaging Het
Il9r T G 11: 32,190,715 D435A probably benign Het
Jakmip2 T C 18: 43,581,960 D167G probably damaging Het
Klrd1 A G 6: 129,595,434 D63G possibly damaging Het
Lactb A G 9: 66,956,015 L439P probably damaging Het
Laptm5 T C 4: 130,933,658 probably benign Het
Lgals1 A G 15: 78,930,023 D96G probably benign Het
Lrp8 A T 4: 107,869,110 H871L probably damaging Het
Mfap4 A T 11: 61,487,930 I235F probably benign Het
Muc6 G A 7: 141,637,923 T2279I possibly damaging Het
Nlrp4b T A 7: 10,715,245 Y91* probably null Het
Osbp2 A G 11: 3,705,593 Y383H probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Palb2 G T 7: 122,128,413 T78K probably benign Het
Panx2 G T 15: 89,060,230 V53L probably damaging Het
Pitx1 T C 13: 55,826,079 Y313C probably damaging Het
Pjvk A G 2: 76,651,560 probably null Het
Pnldc1 T G 17: 12,890,396 K439T probably benign Het
Ppp4r4 A C 12: 103,593,098 T513P probably benign Het
Pram1 A T 17: 33,641,626 Q389L probably damaging Het
Prg4 T C 1: 150,454,453 probably benign Het
Prkch C A 12: 73,691,592 R158S probably damaging Het
Ptpn7 A T 1: 135,143,168 M332L probably damaging Het
Rad51c A T 11: 87,397,633 D241E probably benign Het
Rara T G 11: 98,971,584 I270M possibly damaging Het
Ryr2 T A 13: 11,556,658 D4898V probably damaging Het
Sec31b C T 19: 44,534,371 G218S probably damaging Het
Slc9a1 T A 4: 133,422,071 L736Q probably damaging Het
Slco2a1 A T 9: 103,068,014 D196V probably damaging Het
Sp3 C A 2: 72,970,566 A368S probably benign Het
Stk24 A T 14: 121,294,233 L337Q possibly damaging Het
Tbc1d13 A G 2: 30,137,367 T96A probably benign Het
Tm2d3 G A 7: 65,701,672 G225S probably damaging Het
Tmem55b T C 14: 50,929,038 E161G probably benign Het
Urb2 T C 8: 124,029,912 V786A probably benign Het
Usp54 C T 14: 20,586,076 G300D probably damaging Het
Vmn1r124 T A 7: 21,260,398 N74Y probably damaging Het
Vmn1r77 T A 7: 12,042,025 C175S probably damaging Het
Vmn2r62 G T 7: 42,787,795 Q422K probably benign Het
Vmn2r76 A G 7: 86,225,288 F827S probably damaging Het
Vps52 A G 17: 33,958,301 S106G possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zic2 A G 14: 122,475,815 N47S probably damaging Het
Other mutations in Usp32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00529:Usp32 APN 11 84994426 missense probably damaging 1.00
IGL00701:Usp32 APN 11 85059125 splice site probably null
IGL00848:Usp32 APN 11 85051181 splice site probably benign
IGL00934:Usp32 APN 11 85007076 missense probably damaging 1.00
IGL01019:Usp32 APN 11 85039265 missense probably damaging 0.97
IGL01302:Usp32 APN 11 84988482 missense probably benign 0.05
IGL01444:Usp32 APN 11 85059164 missense probably damaging 0.97
IGL01575:Usp32 APN 11 85022802 missense probably damaging 1.00
IGL01981:Usp32 APN 11 85036524 missense probably benign 0.02
IGL02118:Usp32 APN 11 85032177 nonsense probably null
IGL02159:Usp32 APN 11 85005802 splice site probably null
IGL02227:Usp32 APN 11 84986481 missense probably damaging 1.00
IGL02363:Usp32 APN 11 85044787 missense probably benign 0.01
IGL02524:Usp32 APN 11 85010011 nonsense probably null
IGL02613:Usp32 APN 11 85040070 missense probably damaging 0.99
IGL02720:Usp32 APN 11 85006991 critical splice donor site probably null
IGL02738:Usp32 APN 11 85083806 missense probably damaging 1.00
IGL02929:Usp32 APN 11 84988372 missense probably benign 0.01
IGL03303:Usp32 APN 11 85022832 missense probably damaging 1.00
BB010:Usp32 UTSW 11 85007059 missense probably damaging 1.00
BB020:Usp32 UTSW 11 85007059 missense probably damaging 1.00
PIT4812001:Usp32 UTSW 11 85010074 missense probably damaging 1.00
R0026:Usp32 UTSW 11 85032074 missense possibly damaging 0.48
R0295:Usp32 UTSW 11 85053692 missense probably damaging 0.98
R1320:Usp32 UTSW 11 85017793 missense probably damaging 0.98
R1712:Usp32 UTSW 11 85042580 missense probably benign 0.12
R1922:Usp32 UTSW 11 85007004 nonsense probably null
R1973:Usp32 UTSW 11 85103931 missense probably benign 0.09
R2010:Usp32 UTSW 11 85040004 missense probably damaging 0.98
R2082:Usp32 UTSW 11 85030512 missense probably damaging 0.99
R2355:Usp32 UTSW 11 85005909 missense probably benign 0.34
R3147:Usp32 UTSW 11 85029087 missense probably damaging 1.00
R3160:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3162:Usp32 UTSW 11 85025536 missense probably damaging 0.97
R3716:Usp32 UTSW 11 85042563 missense probably damaging 1.00
R3816:Usp32 UTSW 11 84994384 critical splice donor site probably null
R3870:Usp32 UTSW 11 85007055 nonsense probably null
R3871:Usp32 UTSW 11 85081156 missense probably null 0.81
R4041:Usp32 UTSW 11 85017739 missense probably benign 0.40
R4079:Usp32 UTSW 11 85039229 missense probably damaging 0.98
R4332:Usp32 UTSW 11 85103978 missense possibly damaging 0.79
R4396:Usp32 UTSW 11 85053975 missense probably benign
R4580:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4620:Usp32 UTSW 11 85059127 critical splice donor site probably null
R4744:Usp32 UTSW 11 84994393 missense probably damaging 1.00
R4909:Usp32 UTSW 11 85055772 nonsense probably null
R5056:Usp32 UTSW 11 85026795 missense probably benign 0.07
R5111:Usp32 UTSW 11 85077331 missense possibly damaging 0.95
R5213:Usp32 UTSW 11 85022259 missense probably damaging 1.00
R5308:Usp32 UTSW 11 85017718 missense probably benign 0.12
R5538:Usp32 UTSW 11 85017786 missense possibly damaging 0.65
R5659:Usp32 UTSW 11 85077414 missense possibly damaging 0.94
R6006:Usp32 UTSW 11 84992451 critical splice donor site probably null
R6011:Usp32 UTSW 11 85032097 missense possibly damaging 0.70
R6029:Usp32 UTSW 11 85025582 missense probably damaging 0.99
R6074:Usp32 UTSW 11 84994573 missense probably benign 0.00
R6331:Usp32 UTSW 11 84986576 missense possibly damaging 0.92
R6353:Usp32 UTSW 11 85022281 missense probably benign
R6714:Usp32 UTSW 11 85026870 missense probably damaging 0.99
R6778:Usp32 UTSW 11 85025686 missense probably benign 0.00
R6988:Usp32 UTSW 11 85010143 missense probably benign 0.35
R6992:Usp32 UTSW 11 85032088 missense probably damaging 0.99
R7182:Usp32 UTSW 11 85040170 missense probably benign 0.34
R7186:Usp32 UTSW 11 85051234 missense probably benign 0.45
R7198:Usp32 UTSW 11 85022855 frame shift probably null
R7201:Usp32 UTSW 11 85022855 frame shift probably null
R7469:Usp32 UTSW 11 84988553 missense possibly damaging 0.94
R7502:Usp32 UTSW 11 85022898 missense possibly damaging 0.48
R7513:Usp32 UTSW 11 85027112 nonsense probably null
R7629:Usp32 UTSW 11 85019855 frame shift probably null
R7703:Usp32 UTSW 11 85077327 missense probably damaging 0.99
R7741:Usp32 UTSW 11 84987281 missense probably damaging 0.99
R7765:Usp32 UTSW 11 84994408 missense probably damaging 1.00
R7933:Usp32 UTSW 11 85007059 missense probably damaging 1.00
R7973:Usp32 UTSW 11 85022808 missense probably damaging 0.99
R7989:Usp32 UTSW 11 85034300 missense
R7998:Usp32 UTSW 11 84994426 missense probably damaging 1.00
R8292:Usp32 UTSW 11 85077401 missense probably damaging 0.99
R8305:Usp32 UTSW 11 85032185 missense possibly damaging 0.83
R8548:Usp32 UTSW 11 85017827 missense possibly damaging 0.52
R8924:Usp32 UTSW 11 85025544 missense probably damaging 0.98
R9002:Usp32 UTSW 11 85053951 missense probably damaging 0.96
R9145:Usp32 UTSW 11 85022292 missense probably damaging 1.00
R9209:Usp32 UTSW 11 85040012 missense probably damaging 0.98
R9211:Usp32 UTSW 11 85022733 missense probably damaging 1.00
R9296:Usp32 UTSW 11 85017652 missense probably damaging 1.00
R9310:Usp32 UTSW 11 85051202 missense probably benign 0.29
R9417:Usp32 UTSW 11 84994543 missense probably damaging 1.00
R9514:Usp32 UTSW 11 85022734 missense probably damaging 0.99
X0028:Usp32 UTSW 11 84992606 missense probably benign 0.05
Z1177:Usp32 UTSW 11 84988612 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACCTCATCACTACACTATTAAGC -3'
(R):5'- TTCAGGATAAACTAACGGGCC -3'

Sequencing Primer
(F):5'- GCAAAGAGCTATGAAATCTACAGG -3'
(R):5'- TTCAGGATAAACTAACGGGCCAAAAG -3'
Posted On 2016-08-04