Incidental Mutation 'R5381:Zic2'
ID424751
Institutional Source Beutler Lab
Gene Symbol Zic2
Ensembl Gene ENSMUSG00000061524
Gene Namezinc finger protein of the cerebellum 2
Synonymsodd-paired homolog, GENA 29, Ku
MMRRC Submission 042956-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R5381 (G1)
Quality Score137
Status Validated
Chromosome14
Chromosomal Location122475435-122479852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122475815 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 47 (N47S)
Ref Sequence ENSEMBL: ENSMUSP00000075283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075888]
Predicted Effect probably damaging
Transcript: ENSMUST00000075888
AA Change: N47S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075283
Gene: ENSMUSG00000061524
AA Change: N47S

DomainStartEndE-ValueType
low complexity region 18 33 N/A INTRINSIC
low complexity region 81 103 N/A INTRINSIC
low complexity region 131 150 N/A INTRINSIC
low complexity region 215 241 N/A INTRINSIC
ZnF_C2H2 265 290 5.68e1 SMART
ZnF_C2H2 299 326 6.92e0 SMART
ZnF_C2H2 332 356 8.02e-5 SMART
ZnF_C2H2 362 386 1.69e-3 SMART
ZnF_C2H2 392 414 4.54e-4 SMART
low complexity region 416 434 N/A INTRINSIC
low complexity region 455 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177306
Meta Mutation Damage Score 0.0722 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ZIC family of C2H2-type zinc finger proteins. This protein functions as a transcriptional repressor and may regulate tissue specific expression of dopamine receptor D1. Expansion of an alanine repeat in the C-terminus of the encoded protein and other mutations in this gene cause holoprosencephaly type 5. Holoprosencephaly is the most common structural anomaly of the human brain. A polyhistidine tract polymorphism in this gene may be associated with increased risk of neural tube defects. This gene is closely linked to a gene encoding zinc finger protein of the cerebellum 5, a related family member on chromosome 13. [provided by RefSeq, Jul 2016]
PHENOTYPE: Defects in neurulation and forebrain development have been identified in both targeted and ENU induced homozygous mutants. Death occurs perinatally in the targeted mouse and during midgestation in the ENU mouse. Mice homozygous for a knock-down allele exhibit cognitive and social behavior defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011H14Rik T C 14: 49,232,907 D185G probably damaging Het
1700086D15Rik G T 11: 65,153,311 S19* probably null Het
4930432E11Rik A T 7: 29,562,968 noncoding transcript Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Ankmy1 T C 1: 92,876,562 T900A probably benign Het
Anp32a A C 9: 62,372,177 E107A probably damaging Het
Arhgef40 T C 14: 51,991,849 I623T probably damaging Het
Camsap3 T A 8: 3,603,812 I483N probably damaging Het
Card9 G A 2: 26,358,883 L85F probably damaging Het
Cbfa2t2 T G 2: 154,523,929 V353G probably damaging Het
Ccdc166 A T 15: 75,980,852 L422* probably null Het
Ccdc73 A T 2: 104,989,925 N416Y probably damaging Het
Celsr2 A T 3: 108,402,757 D1552E probably damaging Het
Ces1b A T 8: 93,065,019 N317K probably benign Het
Col6a3 T C 1: 90,775,612 R2471G unknown Het
Crocc C T 4: 141,029,311 R1165H possibly damaging Het
Csmd3 T A 15: 47,741,215 Y1955F probably benign Het
Ctbp1 A T 5: 33,249,690 D232E probably benign Het
Cuedc1 T A 11: 88,187,986 probably null Het
Dctd C T 8: 48,137,414 probably benign Het
Dusp6 G A 10: 99,266,267 V226I possibly damaging Het
Gpr152 A G 19: 4,142,517 E19G probably damaging Het
Ighv16-1 T C 12: 114,068,973 T70A probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Il12b C A 11: 44,407,872 D51E possibly damaging Het
Il9r T G 11: 32,190,715 D435A probably benign Het
Jakmip2 T C 18: 43,581,960 D167G probably damaging Het
Klrd1 A G 6: 129,595,434 D63G possibly damaging Het
Lactb A G 9: 66,956,015 L439P probably damaging Het
Laptm5 T C 4: 130,933,658 probably benign Het
Lgals1 A G 15: 78,930,023 D96G probably benign Het
Lrp8 A T 4: 107,869,110 H871L probably damaging Het
Mfap4 A T 11: 61,487,930 I235F probably benign Het
Muc6 G A 7: 141,637,923 T2279I possibly damaging Het
Nlrp4b T A 7: 10,715,245 Y91* probably null Het
Osbp2 A G 11: 3,705,593 Y383H probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Palb2 G T 7: 122,128,413 T78K probably benign Het
Panx2 G T 15: 89,060,230 V53L probably damaging Het
Pitx1 T C 13: 55,826,079 Y313C probably damaging Het
Pjvk A G 2: 76,651,560 probably null Het
Pnldc1 T G 17: 12,890,396 K439T probably benign Het
Ppp4r4 A C 12: 103,593,098 T513P probably benign Het
Pram1 A T 17: 33,641,626 Q389L probably damaging Het
Prg4 T C 1: 150,454,453 probably benign Het
Prkch C A 12: 73,691,592 R158S probably damaging Het
Ptpn7 A T 1: 135,143,168 M332L probably damaging Het
Rad51c A T 11: 87,397,633 D241E probably benign Het
Rara T G 11: 98,971,584 I270M possibly damaging Het
Ryr2 T A 13: 11,556,658 D4898V probably damaging Het
Sec31b C T 19: 44,534,371 G218S probably damaging Het
Slc9a1 T A 4: 133,422,071 L736Q probably damaging Het
Slco2a1 A T 9: 103,068,014 D196V probably damaging Het
Sp3 C A 2: 72,970,566 A368S probably benign Het
Stk24 A T 14: 121,294,233 L337Q possibly damaging Het
Tbc1d13 A G 2: 30,137,367 T96A probably benign Het
Tm2d3 G A 7: 65,701,672 G225S probably damaging Het
Tmem55b T C 14: 50,929,038 E161G probably benign Het
Urb2 T C 8: 124,029,912 V786A probably benign Het
Usp32 C T 11: 85,059,127 probably benign Het
Usp54 C T 14: 20,586,076 G300D probably damaging Het
Vmn1r124 T A 7: 21,260,398 N74Y probably damaging Het
Vmn1r77 T A 7: 12,042,025 C175S probably damaging Het
Vmn2r62 G T 7: 42,787,795 Q422K probably benign Het
Vmn2r76 A G 7: 86,225,288 F827S probably damaging Het
Vps52 A G 17: 33,958,301 S106G possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Other mutations in Zic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Zic2 APN 14 122478559 nonsense probably null
IGL01607:Zic2 APN 14 122478882 splice site probably benign
IGL02307:Zic2 APN 14 122476634 missense possibly damaging 0.76
IGL02311:Zic2 APN 14 122476194 missense probably damaging 0.99
IGL02561:Zic2 APN 14 122478545 nonsense probably null
IGL02982:Zic2 APN 14 122478567 missense probably damaging 0.98
R0001:Zic2 UTSW 14 122478957 missense probably damaging 0.99
R0027:Zic2 UTSW 14 122476343 missense possibly damaging 0.77
R0136:Zic2 UTSW 14 122476541 missense probably damaging 0.96
R0310:Zic2 UTSW 14 122476364 small deletion probably benign
R0418:Zic2 UTSW 14 122476364 small deletion probably benign
R0420:Zic2 UTSW 14 122476364 small deletion probably benign
R0421:Zic2 UTSW 14 122476364 small deletion probably benign
R0518:Zic2 UTSW 14 122476364 small deletion probably benign
R0520:Zic2 UTSW 14 122476364 small deletion probably benign
R0521:Zic2 UTSW 14 122476364 small deletion probably benign
R0628:Zic2 UTSW 14 122476364 small deletion probably benign
R1733:Zic2 UTSW 14 122478947 missense probably damaging 0.97
R1757:Zic2 UTSW 14 122478619 missense possibly damaging 0.86
R2398:Zic2 UTSW 14 122478917 nonsense probably null
R5323:Zic2 UTSW 14 122476316 missense probably damaging 1.00
R6930:Zic2 UTSW 14 122476457 missense probably damaging 0.99
R7223:Zic2 UTSW 14 122476091 missense probably damaging 0.98
Z1088:Zic2 UTSW 14 122478675 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCGCCAGTATTTCCACC -3'
(R):5'- AATAGGAGCCAACGTGTGCG -3'

Sequencing Primer
(F):5'- CAGTATTTCCACCGCCGG -3'
(R):5'- CCAACGTGTGCGGCGTG -3'
Posted On2016-08-04