Incidental Mutation 'R5382:Tgfbrap1'
ID 424763
Institutional Source Beutler Lab
Gene Symbol Tgfbrap1
Ensembl Gene ENSMUSG00000070939
Gene Name transforming growth factor, beta receptor associated protein 1
Synonyms 3110018K12Rik
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R5382 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 43047200-43098637 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43075865 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 25 (I25T)
Ref Sequence ENSEMBL: ENSMUSP00000140413 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095014] [ENSMUST00000186694] [ENSMUST00000188728] [ENSMUST00000189010] [ENSMUST00000190427]
AlphaFold Q3UR70
Predicted Effect probably benign
Transcript: ENSMUST00000095014
AA Change: I25T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092624
Gene: ENSMUSG00000070939
AA Change: I25T

DomainStartEndE-ValueType
Pfam:CNH 30 293 3.3e-15 PFAM
Pfam:Vps39_1 448 550 3.3e-26 PFAM
Pfam:Clathrin 572 730 5.3e-13 PFAM
Pfam:Vps39_2 738 846 2e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186694
AA Change: I25T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140132
Gene: ENSMUSG00000070939
AA Change: I25T

DomainStartEndE-ValueType
Pfam:CNH 29 293 1.4e-17 PFAM
Pfam:Vps39_1 448 550 4.5e-26 PFAM
Pfam:Clathrin 571 730 8.4e-13 PFAM
Pfam:Vps39_2 738 846 4e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187872
Predicted Effect probably benign
Transcript: ENSMUST00000188728
SMART Domains Protein: ENSMUSP00000140169
Gene: ENSMUSG00000070939

DomainStartEndE-ValueType
Pfam:Vps39_1 218 254 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189010
AA Change: I25T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000190427
SMART Domains Protein: ENSMUSP00000140384
Gene: ENSMUSG00000070939

DomainStartEndE-ValueType
Pfam:CNH 1 53 2e-4 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to transforming growth factor-beta (TGF-beta) receptors and plays a role in TGF-beta signaling. The encoded protein acts as a chaprone in signaling downstream of TGF-beta. It is involved in signal-dependent association with SMAD4. The protein is also a component of mammalian CORVET, a multisubunit tethering protein complex that is involved in fusion of early endosomes. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Tgfbrap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Tgfbrap1 APN 1 43060123 missense probably damaging 0.98
IGL02142:Tgfbrap1 APN 1 43062592 missense probably damaging 1.00
IGL02386:Tgfbrap1 APN 1 43075821 missense probably damaging 1.00
IGL02667:Tgfbrap1 APN 1 43067620 missense probably benign 0.04
IGL03039:Tgfbrap1 APN 1 43075928 missense possibly damaging 0.76
askew UTSW 1 43059129 missense probably benign 0.22
R0245:Tgfbrap1 UTSW 1 43075592 missense possibly damaging 0.73
R0609:Tgfbrap1 UTSW 1 43060141 missense probably benign 0.24
R0624:Tgfbrap1 UTSW 1 43059129 missense probably benign 0.22
R1111:Tgfbrap1 UTSW 1 43051976 missense probably benign 0.07
R1184:Tgfbrap1 UTSW 1 43049696 missense possibly damaging 0.65
R1469:Tgfbrap1 UTSW 1 43075458 missense probably benign 0.03
R1469:Tgfbrap1 UTSW 1 43075458 missense probably benign 0.03
R1571:Tgfbrap1 UTSW 1 43049813 missense probably benign 0.21
R1615:Tgfbrap1 UTSW 1 43051985 missense probably benign 0.00
R1704:Tgfbrap1 UTSW 1 43054656 missense probably benign 0.00
R1773:Tgfbrap1 UTSW 1 43075352 missense probably damaging 1.00
R1834:Tgfbrap1 UTSW 1 43071635 missense probably damaging 1.00
R2019:Tgfbrap1 UTSW 1 43054517 critical splice donor site probably null
R2038:Tgfbrap1 UTSW 1 43054634 nonsense probably null
R2926:Tgfbrap1 UTSW 1 43075629 missense probably damaging 1.00
R3842:Tgfbrap1 UTSW 1 43059154 missense probably damaging 0.98
R4345:Tgfbrap1 UTSW 1 43056706 missense probably benign 0.02
R5133:Tgfbrap1 UTSW 1 43075506 missense probably damaging 0.96
R5200:Tgfbrap1 UTSW 1 43075643 missense probably damaging 1.00
R5715:Tgfbrap1 UTSW 1 43059937 missense possibly damaging 0.64
R6860:Tgfbrap1 UTSW 1 43067599 missense possibly damaging 0.63
R6921:Tgfbrap1 UTSW 1 43051896 missense probably benign
R6937:Tgfbrap1 UTSW 1 43051904 missense probably damaging 0.99
R7090:Tgfbrap1 UTSW 1 43071565 missense probably damaging 0.99
R7359:Tgfbrap1 UTSW 1 43075533 missense probably damaging 1.00
R8318:Tgfbrap1 UTSW 1 43056669 missense probably damaging 0.97
R8354:Tgfbrap1 UTSW 1 43075910 missense probably damaging 1.00
R8874:Tgfbrap1 UTSW 1 43075813 missense probably benign 0.11
R8878:Tgfbrap1 UTSW 1 43049799 nonsense probably null
R9030:Tgfbrap1 UTSW 1 43056677 missense probably benign 0.00
R9150:Tgfbrap1 UTSW 1 43075825 nonsense probably null
R9198:Tgfbrap1 UTSW 1 43054639 missense probably damaging 1.00
R9348:Tgfbrap1 UTSW 1 43054535 missense probably benign 0.00
R9384:Tgfbrap1 UTSW 1 43056752 missense probably damaging 1.00
R9464:Tgfbrap1 UTSW 1 43075448 missense probably damaging 0.99
X0028:Tgfbrap1 UTSW 1 43071650 missense probably damaging 1.00
Z1176:Tgfbrap1 UTSW 1 43060147 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCTCGTTCACAGGTTTCTTG -3'
(R):5'- ACAGGAACTCTTTTCTGTCTGC -3'

Sequencing Primer
(F):5'- ACAGGTTTCTTGAAGCCCAG -3'
(R):5'- CTAAGGGAGTCAGGTTCTTCAG -3'
Posted On 2016-08-04