Incidental Mutation 'R5382:Olfr1016'
ID424767
Institutional Source Beutler Lab
Gene Symbol Olfr1016
Ensembl Gene ENSMUSG00000075209
Gene Nameolfactory receptor 1016
SynonymsMOR213-9, GA_x6K02T2Q125-47278889-47277960
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85797618-85802544 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85800148 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 41 (N41D)
Ref Sequence ENSEMBL: ENSMUSP00000149631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099915] [ENSMUST00000216425] [ENSMUST00000217410]
Predicted Effect probably damaging
Transcript: ENSMUST00000099915
AA Change: N41D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097499
Gene: ENSMUSG00000075209
AA Change: N41D

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 9.8e-51 PFAM
Pfam:7tm_1 40 289 8.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216425
AA Change: N41D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000217410
AA Change: N41D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.5715 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Olfr1016
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01907:Olfr1016 APN 2 85799602 missense probably benign 0.01
IGL02676:Olfr1016 APN 2 85799590 missense possibly damaging 0.55
R0279:Olfr1016 UTSW 2 85799535 missense possibly damaging 0.80
R2982:Olfr1016 UTSW 2 85799350 missense probably benign 0.12
R3708:Olfr1016 UTSW 2 85799998 missense probably benign 0.17
R4014:Olfr1016 UTSW 2 85799476 missense probably damaging 0.99
R4193:Olfr1016 UTSW 2 85800018 missense probably benign 0.39
R4593:Olfr1016 UTSW 2 85799664 missense probably damaging 1.00
R4772:Olfr1016 UTSW 2 85799994 missense probably damaging 1.00
R4816:Olfr1016 UTSW 2 85800047 missense probably benign
R4864:Olfr1016 UTSW 2 85799689 missense probably damaging 1.00
R5886:Olfr1016 UTSW 2 85799803 missense probably damaging 0.96
R6004:Olfr1016 UTSW 2 85799382 missense probably damaging 1.00
R7833:Olfr1016 UTSW 2 85799949 missense probably benign 0.20
R7953:Olfr1016 UTSW 2 85799895 missense probably damaging 1.00
R8113:Olfr1016 UTSW 2 85799667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGCTAGCAAAGGATATGC -3'
(R):5'- CTTTCATGATTACCAGGAGAATGTCTG -3'

Sequencing Primer
(F):5'- AGCAAAGGATATGCTCTTATTTTCAG -3'
(R):5'- CCAGGAGAATGTCTGATTTACCC -3'
Posted On2016-08-04