Incidental Mutation 'R5382:Cyp7b1'
ID424773
Institutional Source Beutler Lab
Gene Symbol Cyp7b1
Ensembl Gene ENSMUSG00000039519
Gene Namecytochrome P450, family 7, subfamily b, polypeptide 1
SynonymsD3Ertd552e, hct-1
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location18071950-18243338 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18097221 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 276 (D276V)
Ref Sequence ENSEMBL: ENSMUSP00000037487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035625]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035625
AA Change: D276V

PolyPhen 2 Score 0.534 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037487
Gene: ENSMUSG00000039519
AA Change: D276V

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
Pfam:p450 44 496 1e-52 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway of extrahepatic tissues, which converts cholesterol to bile acids. This enzyme likely plays a minor role in total bile acid synthesis, but may also be involved in the development of atherosclerosis, neurosteroid metabolism and sex hormone synthesis. Mutations in this gene have been associated with hereditary spastic paraplegia (SPG5 or HSP), an autosomal recessive disorder. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show significantly increased levels of 25- and 27-hydroxycholesterol, and reduced IgA levels. Female mice homozygous for a reporter allele display early onset of puberty and early ovarian failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Cyp7b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Cyp7b1 APN 3 18072575 missense probably damaging 1.00
R0166:Cyp7b1 UTSW 3 18097366 missense probably benign 0.23
R0334:Cyp7b1 UTSW 3 18103796 missense probably damaging 1.00
R0417:Cyp7b1 UTSW 3 18096691 missense probably damaging 1.00
R0696:Cyp7b1 UTSW 3 18072585 missense probably benign 0.23
R0894:Cyp7b1 UTSW 3 18097510 missense probably benign 0.00
R1799:Cyp7b1 UTSW 3 18097452 missense probably benign 0.01
R1893:Cyp7b1 UTSW 3 18096567 missense possibly damaging 0.57
R4538:Cyp7b1 UTSW 3 18097581 missense possibly damaging 0.71
R4692:Cyp7b1 UTSW 3 18072564 missense probably damaging 0.97
R4877:Cyp7b1 UTSW 3 18097293 missense probably damaging 0.98
R5841:Cyp7b1 UTSW 3 18097506 missense probably damaging 1.00
R6867:Cyp7b1 UTSW 3 18097230 missense probably damaging 1.00
R7007:Cyp7b1 UTSW 3 18097618 nonsense probably null
R7379:Cyp7b1 UTSW 3 18097374 missense probably benign 0.23
R7554:Cyp7b1 UTSW 3 18097446 missense probably benign 0.00
R7814:Cyp7b1 UTSW 3 18097302 missense probably benign 0.00
R8137:Cyp7b1 UTSW 3 18097601 missense probably benign 0.23
R8338:Cyp7b1 UTSW 3 18097566 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCATGCTAATGAGAACCAATAGGC -3'
(R):5'- TGCATTCTGTGGCTCACTGG -3'

Sequencing Primer
(F):5'- GCTAATGAGAACCAATAGGCTTCTG -3'
(R):5'- GGCTCACTGGTATTTGAGATCAC -3'
Posted On2016-08-04