Incidental Mutation 'R5382:Zfp644'
ID424779
Institutional Source Beutler Lab
Gene Symbol Zfp644
Ensembl Gene ENSMUSG00000049606
Gene Namezinc finger protein 644
SynonymsD5Ertd689e, 1110068L01Rik, Zep-2, BM-005
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location106616739-106697287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106634869 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1182 (I1182N)
Ref Sequence ENSEMBL: ENSMUSP00000108318 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698] [ENSMUST00000122980] [ENSMUST00000124263] [ENSMUST00000127434] [ENSMUST00000135108] [ENSMUST00000137285] [ENSMUST00000155495]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045466
AA Change: I1182N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: I1182N

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112695
SMART Domains Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Blast:ZnF_C2H2 39 65 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112696
AA Change: I1213N

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: I1213N

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 767 783 N/A INTRINSIC
low complexity region 802 819 N/A INTRINSIC
ZnF_C2H2 959 981 1.07e0 SMART
ZnF_C2H2 1034 1056 1.43e-1 SMART
low complexity region 1230 1243 N/A INTRINSIC
ZnF_C2H2 1257 1283 5.4e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112698
AA Change: I1182N

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: I1182N

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122980
Predicted Effect probably benign
Transcript: ENSMUST00000124263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125895
Predicted Effect probably benign
Transcript: ENSMUST00000127434
SMART Domains Protein: ENSMUSP00000122421
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135108
Predicted Effect probably benign
Transcript: ENSMUST00000137285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149128
Predicted Effect probably benign
Transcript: ENSMUST00000155495
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Other mutations in Zfp644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Zfp644 APN 5 106638637 critical splice acceptor site probably null
IGL01654:Zfp644 APN 5 106635930 missense probably damaging 1.00
IGL01967:Zfp644 APN 5 106638243 missense probably damaging 1.00
IGL02132:Zfp644 APN 5 106635894 missense probably benign 0.22
IGL02164:Zfp644 APN 5 106638099 missense probably benign 0.01
IGL02303:Zfp644 APN 5 106637314 missense probably damaging 1.00
IGL03091:Zfp644 APN 5 106636858 missense probably damaging 1.00
IGL03102:Zfp644 APN 5 106637268 missense probably damaging 0.99
IGL03298:Zfp644 APN 5 106635101 missense possibly damaging 0.93
PIT4466001:Zfp644 UTSW 5 106636477 missense probably damaging 0.99
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0178:Zfp644 UTSW 5 106636905 missense probably damaging 1.00
R0497:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1302:Zfp644 UTSW 5 106634899 missense probably damaging 1.00
R1337:Zfp644 UTSW 5 106637554 missense probably damaging 0.99
R1400:Zfp644 UTSW 5 106637470 splice site probably null
R1597:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1911:Zfp644 UTSW 5 106635271 missense possibly damaging 0.95
R2021:Zfp644 UTSW 5 106635682 missense possibly damaging 0.84
R2196:Zfp644 UTSW 5 106638603 start codon destroyed probably null 0.02
R2256:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R2311:Zfp644 UTSW 5 106634956 missense probably benign 0.21
R2420:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2421:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2422:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R3752:Zfp644 UTSW 5 106636383 missense probably benign
R4207:Zfp644 UTSW 5 106618276 missense probably damaging 1.00
R4285:Zfp644 UTSW 5 106635118 missense probably damaging 1.00
R4874:Zfp644 UTSW 5 106635413 missense probably damaging 1.00
R4961:Zfp644 UTSW 5 106618215 utr 3 prime probably benign
R4984:Zfp644 UTSW 5 106636917 missense possibly damaging 0.96
R5007:Zfp644 UTSW 5 106636001 missense probably benign
R5358:Zfp644 UTSW 5 106635675 missense probably damaging 1.00
R5416:Zfp644 UTSW 5 106618428 splice site silent
R5641:Zfp644 UTSW 5 106619595 missense probably damaging 1.00
R5656:Zfp644 UTSW 5 106637982 missense probably benign 0.12
R5732:Zfp644 UTSW 5 106637123 missense probably damaging 1.00
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6306:Zfp644 UTSW 5 106638124 missense probably damaging 0.99
R6317:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R6354:Zfp644 UTSW 5 106636753 missense probably benign 0.23
R6886:Zfp644 UTSW 5 106637911 missense possibly damaging 0.53
R7223:Zfp644 UTSW 5 106637582 nonsense probably null
R7326:Zfp644 UTSW 5 106638277 missense probably benign 0.12
R7450:Zfp644 UTSW 5 106638526 missense probably benign 0.00
R8095:Zfp644 UTSW 5 106618414 missense possibly damaging 0.93
X0011:Zfp644 UTSW 5 106618427 missense probably damaging 1.00
Z1176:Zfp644 UTSW 5 106635744 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTAATGAGCTACAGCAGAGCC -3'
(R):5'- AGGAAGAAGGGCTGCATTTC -3'

Sequencing Primer
(F):5'- TACAGCAGAGCCAGTGTGC -3'
(R):5'- GAAAGCCTGAACTGCCCAGTG -3'
Posted On2016-08-04