Incidental Mutation 'R5382:Th'
ID 424788
Institutional Source Beutler Lab
Gene Symbol Th
Ensembl Gene ENSMUSG00000000214
Gene Name tyrosine hydroxylase
Synonyms
MMRRC Submission 042957-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5382 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 142892752-142931128 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 142895440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 191 (F191S)
Ref Sequence ENSEMBL: ENSMUSP00000101549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000219] [ENSMUST00000105929] [ENSMUST00000123057] [ENSMUST00000124951] [ENSMUST00000140344]
AlphaFold P24529
Predicted Effect probably damaging
Transcript: ENSMUST00000000219
AA Change: F286S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000219
Gene: ENSMUSG00000000214
AA Change: F286S

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 2.3e-15 PFAM
Pfam:TOH_N 29 49 2.6e-11 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 1e-49 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 495 1.2e-180 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105929
AA Change: F191S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101549
Gene: ENSMUSG00000000214
AA Change: F191S

DomainStartEndE-ValueType
PDB:2MDA|B 8 51 1e-21 PDB
low complexity region 52 63 N/A INTRINSIC
Pfam:Biopterin_H 70 401 2.2e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123057
Predicted Effect probably benign
Transcript: ENSMUST00000124951
SMART Domains Protein: ENSMUSP00000122876
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 2 26 5e-16 PFAM
Pfam:TOH_N 28 49 4.1e-10 PFAM
low complexity region 51 63 N/A INTRINSIC
PDB:2MDA|B 65 146 2e-52 PDB
low complexity region 147 158 N/A INTRINSIC
Pfam:Biopterin_H 165 232 7.2e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138482
Predicted Effect probably benign
Transcript: ENSMUST00000140344
SMART Domains Protein: ENSMUSP00000115434
Gene: ENSMUSG00000000214

DomainStartEndE-ValueType
Pfam:TOH_N 11 29 5.2e-9 PFAM
low complexity region 31 43 N/A INTRINSIC
PDB:2MDA|B 45 126 7e-53 PDB
low complexity region 127 138 N/A INTRINSIC
Pfam:Biopterin_H 145 171 3.9e-11 PFAM
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the conversion of tyrosine to dopamine. It is the rate-limiting enzyme in the synthesis of catecholamines, hence plays a key role in the physiology of adrenergic neurons. Mutations in this gene have been associated with autosomal recessive Segawa syndrome. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are deficient in catecholamines, and usually die around embryonic day 11.5-15.5 due to cardiac failure. Treatment of the pregnant female with dihydroxyphenylalanine prevents prenatal mortality. Mice homozygous for hypomorphic targeted alleles are hypokinetic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Th
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00949:Th APN 7 142897026 missense probably benign 0.01
IGL02308:Th APN 7 142898057 missense possibly damaging 0.69
IGL02417:Th APN 7 142899906 missense probably damaging 1.00
IGL02565:Th APN 7 142899910 missense probably damaging 1.00
IGL02896:Th APN 7 142895431 missense probably damaging 1.00
R0311:Th UTSW 7 142896041 missense probably damaging 1.00
R1072:Th UTSW 7 142894488 missense probably benign
R1595:Th UTSW 7 142897008 missense probably benign 0.06
R1756:Th UTSW 7 142898166 nonsense probably null
R2091:Th UTSW 7 142895543 missense probably damaging 0.98
R2850:Th UTSW 7 142894075 nonsense probably null
R3151:Th UTSW 7 142894075 nonsense probably null
R4458:Th UTSW 7 142896953 missense probably benign 0.41
R4870:Th UTSW 7 142894097 missense probably benign
R7874:Th UTSW 7 142895571 nonsense probably null
R8049:Th UTSW 7 142894123 missense probably damaging 1.00
R8425:Th UTSW 7 142894086 missense possibly damaging 0.86
R8431:Th UTSW 7 142893064 missense probably benign 0.00
R8970:Th UTSW 7 142893059 missense probably damaging 1.00
R9484:Th UTSW 7 142899883 nonsense probably null
R9745:Th UTSW 7 142895114 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATATTACTGGGCAACAAGTTCAG -3'
(R):5'- AGGTATACGCCACGCTGAAG -3'

Sequencing Primer
(F):5'- AACAAGTTCAGGGTCCTCTG -3'
(R):5'- AAGGGCCTCTATGCTACCCATG -3'
Posted On 2016-08-04