Incidental Mutation 'R5382:Evi5l'
ID424789
Institutional Source Beutler Lab
Gene Symbol Evi5l
Ensembl Gene ENSMUSG00000011832
Gene Nameecotropic viral integration site 5 like
Synonyms
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location4166567-4211257 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 4178653 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176072] [ENSMUST00000176149] [ENSMUST00000176764] [ENSMUST00000176825] [ENSMUST00000177053]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148353
Predicted Effect probably benign
Transcript: ENSMUST00000176072
SMART Domains Protein: ENSMUSP00000134867
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 415 451 4.14e-7 PROSPERO
coiled coil region 455 478 N/A INTRINSIC
internal_repeat_1 513 549 4.14e-7 PROSPERO
low complexity region 697 708 N/A INTRINSIC
low complexity region 732 743 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176149
SMART Domains Protein: ENSMUSP00000135479
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 463 509 1.56e-7 PROSPERO
coiled coil region 513 536 N/A INTRINSIC
internal_repeat_1 563 607 1.56e-7 PROSPERO
low complexity region 755 766 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176462
Predicted Effect probably benign
Transcript: ENSMUST00000176764
SMART Domains Protein: ENSMUSP00000134857
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 4e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
coiled coil region 363 452 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176825
SMART Domains Protein: ENSMUSP00000135700
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 2e-7 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
internal_repeat_1 452 498 1.86e-7 PROSPERO
coiled coil region 502 525 N/A INTRINSIC
internal_repeat_1 552 596 1.86e-7 PROSPERO
low complexity region 744 755 N/A INTRINSIC
low complexity region 779 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177053
SMART Domains Protein: ENSMUSP00000135159
Gene: ENSMUSG00000011832

DomainStartEndE-ValueType
Blast:TBC 27 100 3e-8 BLAST
low complexity region 101 116 N/A INTRINSIC
TBC 117 328 1.57e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177130
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177499
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Evi5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Evi5l APN 8 4193219 critical splice donor site probably null
IGL02143:Evi5l APN 8 4191293 missense probably damaging 0.99
IGL02322:Evi5l APN 8 4187236 splice site probably benign
IGL02528:Evi5l APN 8 4193172 missense probably benign 0.25
IGL02822:Evi5l APN 8 4187248 missense probably damaging 1.00
R0280:Evi5l UTSW 8 4193133 missense probably damaging 1.00
R1764:Evi5l UTSW 8 4203560 missense probably damaging 0.98
R2032:Evi5l UTSW 8 4210622 missense probably damaging 1.00
R2158:Evi5l UTSW 8 4193195 missense probably damaging 0.99
R2175:Evi5l UTSW 8 4187269 missense probably damaging 1.00
R2357:Evi5l UTSW 8 4193113 splice site probably benign
R3055:Evi5l UTSW 8 4191603 nonsense probably null
R3724:Evi5l UTSW 8 4178080 intron probably benign
R3956:Evi5l UTSW 8 4191358 missense possibly damaging 0.72
R4342:Evi5l UTSW 8 4183492 utr 5 prime probably benign
R4621:Evi5l UTSW 8 4202909 intron probably benign
R4622:Evi5l UTSW 8 4202909 intron probably benign
R4959:Evi5l UTSW 8 4205406 missense probably benign 0.00
R4973:Evi5l UTSW 8 4205406 missense probably benign 0.00
R5052:Evi5l UTSW 8 4206019 intron probably benign
R5097:Evi5l UTSW 8 4193317 missense probably damaging 0.97
R5344:Evi5l UTSW 8 4185990 missense possibly damaging 0.78
R5357:Evi5l UTSW 8 4203623 missense possibly damaging 0.63
R5376:Evi5l UTSW 8 4210770 missense probably damaging 0.99
R5500:Evi5l UTSW 8 4191658 missense probably damaging 0.96
R5554:Evi5l UTSW 8 4206491 splice site probably benign
R5689:Evi5l UTSW 8 4205460 nonsense probably null
R5788:Evi5l UTSW 8 4206800 utr 3 prime probably benign
R6321:Evi5l UTSW 8 4203080 missense probably benign
R6520:Evi5l UTSW 8 4205906 missense possibly damaging 0.76
R6620:Evi5l UTSW 8 4206674 missense possibly damaging 0.84
R6707:Evi5l UTSW 8 4206322 missense probably benign
R7232:Evi5l UTSW 8 4205906 missense possibly damaging 0.71
R7692:Evi5l UTSW 8 4200886 missense probably damaging 1.00
R7985:Evi5l UTSW 8 4203536 missense probably benign 0.27
R8162:Evi5l UTSW 8 4191300 missense probably damaging 1.00
R8512:Evi5l UTSW 8 4193121 missense probably benign 0.01
X0062:Evi5l UTSW 8 4191303 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAAACGTCTAGTGAGAAACTGC -3'
(R):5'- GCCCGCCAGACTGATAAATC -3'

Sequencing Primer
(F):5'- CGTCTAGTGAGAAACTGCTAGATCC -3'
(R):5'- CGTAAGTATACCATATGCGTGCCTG -3'
Posted On2016-08-04