Incidental Mutation 'R0491:Mmp11'
ID42479
Institutional Source Beutler Lab
Gene Symbol Mmp11
Ensembl Gene ENSMUSG00000000901
Gene Namematrix metallopeptidase 11
SynonymsST3, stromelysin 3, Stmy3
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0491 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75923222-75936496 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75926758 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 287 (A287V)
Ref Sequence ENSEMBL: ENSMUSP00000112940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000924] [ENSMUST00000120281] [ENSMUST00000132869] [ENSMUST00000219728]
Predicted Effect probably benign
Transcript: ENSMUST00000000924
AA Change: A287V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000000924
Gene: ENSMUSG00000000901
AA Change: A287V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120281
AA Change: A287V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112940
Gene: ENSMUSG00000000901
AA Change: A287V

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
ZnMc 105 263 2.58e-57 SMART
HX 302 345 1.16e-10 SMART
HX 347 388 1.27e-7 SMART
HX 391 438 7.63e-11 SMART
HX 440 484 6.91e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133897
Predicted Effect probably benign
Transcript: ENSMUST00000152222
SMART Domains Protein: ENSMUSP00000116279
Gene: ENSMUSG00000000901

DomainStartEndE-ValueType
Blast:HX 2 26 1e-8 BLAST
HX 29 76 7.63e-11 SMART
HX 78 117 1.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000219728
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of endopeptidases that are involved in remodeling extracellular matrix during, for example, embryonic development and tumor progression. The encoded protein undergoes post-translational proteolytic processing by furin endopeptidase to form an active enzyme. Subcutaneous introduction of cells expressing the encoded protein into nude mice results in increased tumor incidence. Mice lacking the encoded protein exhibit a decreased incidence of chemically-induced tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous null mice exhibit a decreased incidence of DMBA-induced carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Mmp11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Mmp11 APN 10 75926821 missense probably benign 0.00
IGL01690:Mmp11 APN 10 75926896 missense probably damaging 1.00
IGL01804:Mmp11 APN 10 75928470 missense probably benign
R0285:Mmp11 UTSW 10 75925668 missense probably damaging 1.00
R0541:Mmp11 UTSW 10 75926933 missense probably damaging 1.00
R1857:Mmp11 UTSW 10 75928357 missense probably benign 0.01
R2400:Mmp11 UTSW 10 75925510 missense probably benign 0.18
R2442:Mmp11 UTSW 10 75927245 missense probably benign 0.09
R3157:Mmp11 UTSW 10 75927114 unclassified probably benign
R3158:Mmp11 UTSW 10 75927114 unclassified probably benign
R3159:Mmp11 UTSW 10 75927114 unclassified probably benign
R4915:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R4917:Mmp11 UTSW 10 75925585 missense probably damaging 1.00
R5137:Mmp11 UTSW 10 75925456 missense probably damaging 1.00
R5848:Mmp11 UTSW 10 75927389 missense probably damaging 1.00
R6156:Mmp11 UTSW 10 75926491 missense probably damaging 1.00
R6313:Mmp11 UTSW 10 75923984 makesense probably null
R6569:Mmp11 UTSW 10 75927382 start gained probably benign
R6753:Mmp11 UTSW 10 75928374 missense probably damaging 1.00
R7027:Mmp11 UTSW 10 75932396 unclassified probably benign
R7146:Mmp11 UTSW 10 75928446 missense probably benign
R7163:Mmp11 UTSW 10 75926576 missense possibly damaging 0.64
R7797:Mmp11 UTSW 10 75923480 missense
Predicted Primers PCR Primer
(F):5'- CGTCGAAGGAAGTCTCACAGACATC -3'
(R):5'- TTCCAGGAACTGACCTGCTGCAAG -3'

Sequencing Primer
(F):5'- AGTCTCACAGACATCTGGCG -3'
(R):5'- TTCTGGGGCTACAACACAC -3'
Posted On2013-05-23