Incidental Mutation 'R5382:Dctd'
ID424790
Institutional Source Beutler Lab
Gene Symbol Dctd
Ensembl Gene ENSMUSG00000031562
Gene NamedCMP deaminase
Synonyms
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location48099092-48153233 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 48137414 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033966] [ENSMUST00000170263] [ENSMUST00000174278] [ENSMUST00000174379] [ENSMUST00000174818]
Predicted Effect probably benign
Transcript: ENSMUST00000033966
SMART Domains Protein: ENSMUSP00000033966
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098773
Predicted Effect probably benign
Transcript: ENSMUST00000170263
SMART Domains Protein: ENSMUSP00000126733
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173991
Predicted Effect probably benign
Transcript: ENSMUST00000174278
SMART Domains Protein: ENSMUSP00000133445
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174379
SMART Domains Protein: ENSMUSP00000134195
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 103 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174818
SMART Domains Protein: ENSMUSP00000134003
Gene: ENSMUSG00000031562

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 131 1.5e-27 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the deamination of dCMP to dUMP, the nucleotide substrate for thymidylate synthase. The encoded protein is allosterically activated by dCTP and inhibited by dTTP, and is found as a homohexamer. This protein uses zinc as a cofactor for its activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Dctd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Dctd APN 8 48111662 start gained probably benign
R0194:Dctd UTSW 8 48112078 missense probably benign 0.01
R4871:Dctd UTSW 8 48137414 intron probably benign
R5007:Dctd UTSW 8 48137414 intron probably benign
R5008:Dctd UTSW 8 48137414 intron probably benign
R5009:Dctd UTSW 8 48137414 intron probably benign
R5010:Dctd UTSW 8 48137414 intron probably benign
R5083:Dctd UTSW 8 48111716 missense probably damaging 1.00
R5381:Dctd UTSW 8 48137414 intron probably benign
R7131:Dctd UTSW 8 48112040 missense probably benign 0.02
R8152:Dctd UTSW 8 48111690 missense probably benign
X0057:Dctd UTSW 8 48140360 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTCCAAGGTGGTGACAGAAATAC -3'
(R):5'- CAATTAAGTCTCGGAATACCTGGC -3'

Sequencing Primer
(F):5'- TTCATGAGCTACAGTCCAAGTC -3'
(R):5'- GTCTCGGAATACCTGGCACCAC -3'
Posted On2016-08-04