Incidental Mutation 'R5382:Rab11fip4'
ID424801
Institutional Source Beutler Lab
Gene Symbol Rab11fip4
Ensembl Gene ENSMUSG00000017639
Gene NameRAB11 family interacting protein 4 (class II)
SynonymsA730072L08Rik, RAB11-FIP4
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5382 (G1)
Quality Score170
Status Validated
Chromosome11
Chromosomal Location79591212-79698023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79690715 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 512 (Y512C)
Ref Sequence ENSEMBL: ENSMUSP00000017783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017783]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017783
AA Change: Y512C

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017783
Gene: ENSMUSG00000017639
AA Change: Y512C

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
SCOP:d1mr8a_ 17 90 2e-4 SMART
Blast:EFh 54 81 2e-10 BLAST
low complexity region 247 252 N/A INTRINSIC
low complexity region 388 405 N/A INTRINSIC
Blast:BRLZ 507 574 7e-24 BLAST
Pfam:RBD-FIP 594 634 1.4e-16 PFAM
Meta Mutation Damage Score 0.0821 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with RAB11 and is thought to be involved in bringing recycling endosome membranes to the cleavage furrow in late cytokinesis. Hypoxic conditions can lead to an upregulation of the encoded protein and enhance the metastatic potential of hepatocellular carcinoma. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Rab11fip4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Rab11fip4 APN 11 79691879 missense possibly damaging 0.70
IGL01867:Rab11fip4 APN 11 79683390 missense probably benign 0.04
R0013:Rab11fip4 UTSW 11 79689653 missense probably benign 0.27
R0277:Rab11fip4 UTSW 11 79686629 missense possibly damaging 0.82
R0737:Rab11fip4 UTSW 11 79683502 missense probably benign
R4975:Rab11fip4 UTSW 11 79619671 missense probably damaging 1.00
R5982:Rab11fip4 UTSW 11 79690775 missense probably benign
R6086:Rab11fip4 UTSW 11 79683480 missense probably damaging 1.00
R6267:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R6296:Rab11fip4 UTSW 11 79690829 critical splice donor site probably null
R7468:Rab11fip4 UTSW 11 79689652 missense probably benign 0.02
R8156:Rab11fip4 UTSW 11 79686589 missense probably benign 0.00
R8307:Rab11fip4 UTSW 11 79690774 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- CTTTACAAGCGCATGATGGAC -3'
(R):5'- TTGGCGATCAGGTAGCTGAG -3'

Sequencing Primer
(F):5'- CGCATGATGGACAAGCTGC -3'
(R):5'- TTCTAAACAGAATCCGGAATGGCTG -3'
Posted On2016-08-04