Incidental Mutation 'R5382:Actn2'
ID424804
Institutional Source Beutler Lab
Gene Symbol Actn2
Ensembl Gene ENSMUSG00000052374
Gene Nameactinin alpha 2
Synonyms
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location12269426-12340760 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12308951 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 133 (M133L)
Ref Sequence ENSEMBL: ENSMUSP00000129609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064204] [ENSMUST00000168193]
Predicted Effect probably benign
Transcript: ENSMUST00000064204
AA Change: M133L

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000067708
Gene: ENSMUSG00000052374
AA Change: M133L

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 2e-16 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000110616
SMART Domains Protein: ENSMUSP00000106246
Gene: ENSMUSG00000052374

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168193
AA Change: M133L

PolyPhen 2 Score 0.371 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129609
Gene: ENSMUSG00000052374
AA Change: M133L

DomainStartEndE-ValueType
CH 40 140 5.22e-23 SMART
CH 153 252 1.77e-25 SMART
low complexity region 255 266 N/A INTRINSIC
Pfam:Spectrin 281 391 7e-18 PFAM
SPEC 404 505 5.81e-24 SMART
SPEC 519 626 6.75e-11 SMART
SPEC 640 739 1.26e0 SMART
EFh 757 785 8.16e-1 SMART
EFh 793 821 7.7e-3 SMART
efhand_Ca_insen 824 890 3.9e-37 SMART
Meta Mutation Damage Score 0.0760 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha actinins belong to the spectrin gene superfamily which represents a diverse group of cytoskeletal proteins, including the alpha and beta spectrins and dystrophins. Alpha actinin is an actin-binding protein with multiple roles in different cell types. In nonmuscle cells, the cytoskeletal isoform is found along microfilament bundles and adherens-type junctions, where it is involved in binding actin to the membrane. In contrast, skeletal, cardiac, and smooth muscle isoforms are localized to the Z-disc and analogous dense bodies, where they help anchor the myofibrillar actin filaments. This gene encodes a muscle-specific, alpha actinin isoform that is expressed in both skeletal and cardiac muscles. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Actn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Actn2 APN 13 12310910 missense possibly damaging 0.50
IGL01909:Actn2 APN 13 12309593 critical splice donor site probably null
IGL01994:Actn2 APN 13 12290677 missense probably benign 0.26
IGL02118:Actn2 APN 13 12276547 intron probably benign
IGL02480:Actn2 APN 13 12276478 missense probably benign 0.02
IGL02827:Actn2 APN 13 12275199 missense probably damaging 1.00
IGL03110:Actn2 APN 13 12309607 missense probably benign 0.02
R0044:Actn2 UTSW 13 12275127 missense possibly damaging 0.51
R0512:Actn2 UTSW 13 12277415 missense probably damaging 1.00
R1623:Actn2 UTSW 13 12340439 missense probably benign
R1983:Actn2 UTSW 13 12278810 missense probably benign 0.00
R1989:Actn2 UTSW 13 12340395 missense probably benign 0.38
R2148:Actn2 UTSW 13 12300949 missense probably damaging 0.99
R2196:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R2254:Actn2 UTSW 13 12296479 missense probably benign 0.20
R2850:Actn2 UTSW 13 12275179 missense probably damaging 0.99
R4391:Actn2 UTSW 13 12290748 missense probably damaging 0.99
R4396:Actn2 UTSW 13 12310879 missense probably damaging 1.00
R4758:Actn2 UTSW 13 12288586 nonsense probably null
R5068:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5069:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5070:Actn2 UTSW 13 12288522 missense possibly damaging 0.78
R5228:Actn2 UTSW 13 12288659 critical splice acceptor site probably null
R5408:Actn2 UTSW 13 12270795 missense probably benign 0.41
R5975:Actn2 UTSW 13 12340497 missense probably benign 0.43
R6189:Actn2 UTSW 13 12276440 missense probably damaging 1.00
R6226:Actn2 UTSW 13 12278967 missense probably benign
R6498:Actn2 UTSW 13 12276473 missense probably damaging 1.00
R7094:Actn2 UTSW 13 12309657 missense probably damaging 1.00
R7164:Actn2 UTSW 13 12278961 missense probably damaging 1.00
R7218:Actn2 UTSW 13 12278913 missense probably benign 0.33
R7260:Actn2 UTSW 13 12276490 missense probably benign 0.00
R7768:Actn2 UTSW 13 12282594 missense possibly damaging 0.72
R7896:Actn2 UTSW 13 12294317 missense possibly damaging 0.76
R8141:Actn2 UTSW 13 12288630 missense probably damaging 1.00
X0018:Actn2 UTSW 13 12269645 missense probably damaging 1.00
Z1177:Actn2 UTSW 13 12288562 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAGATGCCTCCCGTTTGATCG -3'
(R):5'- CTGCATTGACCAAGCATATGC -3'

Sequencing Primer
(F):5'- ATCGTGCAAGTGACTGCTCAG -3'
(R):5'- GCGAGACTGGTACTTATCACTAACG -3'
Posted On2016-08-04