Incidental Mutation 'R5382:Phactr1'
ID424805
Institutional Source Beutler Lab
Gene Symbol Phactr1
Ensembl Gene ENSMUSG00000054728
Gene Namephosphatase and actin regulator 1
SynonymsRpel1, 9630030F18Rik
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location42680623-43138526 bp(+) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) T to C at 43135219 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066928] [ENSMUST00000110161] [ENSMUST00000128646] [ENSMUST00000131942] [ENSMUST00000148891] [ENSMUST00000149235]
Predicted Effect probably benign
Transcript: ENSMUST00000066928
SMART Domains Protein: ENSMUSP00000066663
Gene: ENSMUSG00000054728

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 219 239 N/A INTRINSIC
low complexity region 252 269 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
low complexity region 388 399 N/A INTRINSIC
RPEL 415 440 1.23e-6 SMART
RPEL 453 478 5.14e-9 SMART
RPEL 491 516 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110161
SMART Domains Protein: ENSMUSP00000105790
Gene: ENSMUSG00000054728

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 223 232 N/A INTRINSIC
low complexity region 295 315 N/A INTRINSIC
low complexity region 328 345 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
low complexity region 464 475 N/A INTRINSIC
RPEL 491 516 1.23e-6 SMART
RPEL 529 554 5.14e-9 SMART
RPEL 567 592 2.71e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123987
Predicted Effect probably benign
Transcript: ENSMUST00000128646
SMART Domains Protein: ENSMUSP00000122232
Gene: ENSMUSG00000054728

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131942
SMART Domains Protein: ENSMUSP00000123346
Gene: ENSMUSG00000054728

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
RPEL 46 71 7.33e-5 SMART
low complexity region 85 103 N/A INTRINSIC
low complexity region 131 140 N/A INTRINSIC
low complexity region 203 223 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 372 383 N/A INTRINSIC
RPEL 399 424 1.23e-6 SMART
RPEL 437 462 5.14e-9 SMART
RPEL 475 500 2.71e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140651
Predicted Effect probably benign
Transcript: ENSMUST00000148891
SMART Domains Protein: ENSMUSP00000115228
Gene: ENSMUSG00000054728

DomainStartEndE-ValueType
low complexity region 4 42 N/A INTRINSIC
low complexity region 43 61 N/A INTRINSIC
low complexity region 113 127 N/A INTRINSIC
RPEL 131 156 7.33e-5 SMART
low complexity region 170 188 N/A INTRINSIC
low complexity region 216 225 N/A INTRINSIC
low complexity region 288 308 N/A INTRINSIC
low complexity region 321 338 N/A INTRINSIC
low complexity region 399 410 N/A INTRINSIC
low complexity region 457 468 N/A INTRINSIC
RPEL 484 509 1.23e-6 SMART
RPEL 522 547 5.14e-9 SMART
RPEL 560 585 2.71e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149235
SMART Domains Protein: ENSMUSP00000115207
Gene: ENSMUSG00000054728

DomainStartEndE-ValueType
low complexity region 35 49 N/A INTRINSIC
low complexity region 50 68 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
RPEL 138 163 7.33e-5 SMART
low complexity region 177 195 N/A INTRINSIC
low complexity region 226 246 N/A INTRINSIC
low complexity region 259 276 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
RPEL 422 447 1.23e-6 SMART
RPEL 460 485 5.14e-9 SMART
RPEL 498 523 2.71e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161201
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the phosphatase and actin regulator family of proteins. This family member can bind actin and regulate the reorganization of the actin cytoskeleton. It plays a role in tubule formation and in endothelial cell survival. Polymorphisms in this gene are associated with susceptibility to myocardial infarction, coronary artery disease and cervical artery dissection. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Phactr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Phactr1 APN 13 42956646 missense probably damaging 0.99
IGL01144:Phactr1 APN 13 43037524 missense possibly damaging 0.93
IGL02193:Phactr1 APN 13 42709700 splice site probably benign
IGL02691:Phactr1 APN 13 43077737 missense probably benign 0.38
R0028:Phactr1 UTSW 13 43057179 missense probably damaging 1.00
R0060:Phactr1 UTSW 13 42682721 nonsense probably null
R0522:Phactr1 UTSW 13 43059591 missense probably benign 0.00
R1354:Phactr1 UTSW 13 43057331 missense possibly damaging 0.91
R1382:Phactr1 UTSW 13 43132975 missense probably damaging 1.00
R1496:Phactr1 UTSW 13 43094990 missense probably damaging 0.98
R1620:Phactr1 UTSW 13 43094897 missense probably damaging 1.00
R1638:Phactr1 UTSW 13 42956671 missense probably damaging 1.00
R1679:Phactr1 UTSW 13 43057280 missense possibly damaging 0.65
R1679:Phactr1 UTSW 13 43094781 missense possibly damaging 0.94
R2055:Phactr1 UTSW 13 43077940 missense probably damaging 1.00
R2137:Phactr1 UTSW 13 43135175 missense possibly damaging 0.77
R2276:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R2279:Phactr1 UTSW 13 43077789 missense possibly damaging 0.86
R3122:Phactr1 UTSW 13 43059573 missense possibly damaging 0.94
R4073:Phactr1 UTSW 13 43059769 intron probably benign
R4131:Phactr1 UTSW 13 43037477 missense probably damaging 0.99
R4237:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4238:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4239:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4240:Phactr1 UTSW 13 43094887 missense possibly damaging 0.94
R4507:Phactr1 UTSW 13 43096794 missense probably damaging 0.96
R4602:Phactr1 UTSW 13 43094965 missense probably benign 0.00
R4914:Phactr1 UTSW 13 43133963 missense possibly damaging 0.58
R5882:Phactr1 UTSW 13 42709851 critical splice donor site probably null
R6253:Phactr1 UTSW 13 43094771 missense probably benign 0.06
R6451:Phactr1 UTSW 13 43132993 missense probably damaging 1.00
R6808:Phactr1 UTSW 13 43132969 missense probably damaging 1.00
R7061:Phactr1 UTSW 13 43132981 missense probably damaging 1.00
R7847:Phactr1 UTSW 13 43057188 missense possibly damaging 0.96
R7912:Phactr1 UTSW 13 42709763 missense probably benign 0.08
R7937:Phactr1 UTSW 13 43077729 missense unknown
R8344:Phactr1 UTSW 13 42709821 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TGTCATGGGTGGGAAGTCAC -3'
(R):5'- AATGCTGAGGAGTGCTCAC -3'

Sequencing Primer
(F):5'- TGGGAAGTCACACCGGCATC -3'
(R):5'- TGCACACAGAATCCTGGCTG -3'
Posted On2016-08-04