Mutagenetix > Incidental Mutation

Incidental Mutation 'R5382:Krt79'

424811

Institutional Source

Beutler Lab

Gene Symbol

Krt79

Ensembl Gene

ENSMUSG00000061397

Gene Name

keratin 79

Synonyms

MMRRC Submission

042957-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5382 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101929332-101940324 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101931440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 373 (D373E)

Ref Sequence

ENSEMBL: ENSMUSP00000023799 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023799]

AlphaFold

Q8VED5

Predicted Effect

probably benign
Transcript: ENSMUST00000023799
AA Change: D373E

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000023799
Gene: ENSMUSG00000061397
AA Change: D373E

Domain	Start	End	E-Value	Type
Pfam:Keratin_2_head	15	98	6.6e-11	PFAM
Pfam:Keratin_2_head	73	135	1.2e-21	PFAM
Filament	138	452	7.12e-159	SMART
low complexity region	474	500	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229195

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230441

Meta Mutation Damage Score

0.1190

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into epithelial keratins and hair keratins. This gene encodes an epithelial keratin that is expressed in skeletal muscle, skin and scalp. The type II keratins are clustered in a region of chromosome 12q13.[provided by RefSeq, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	G	T	6: 149,326,460	E335*	probably null	Het
Acp7	G	A	7: 28,615,419	P250S	possibly damaging	Het
Actn2	T	A	13: 12,308,951	M133L	probably benign	Het
AI314180	A	T	4: 58,850,934	M413K	probably benign	Het
Arhgap32	A	T	9: 32,152,010	K105M	probably damaging	Het
BC034090	A	G	1: 155,225,603	V305A	probably benign	Het
Brd1	G	A	15: 88,729,564	T376M	probably damaging	Het
Cbl	C	T	9: 44,159,021	A505T	probably benign	Het
Cga	G	T	4: 34,904,048	M14I	probably benign	Het
Cluh	T	C	11: 74,665,109		probably benign	Het
Col14a1	A	T	15: 55,362,436	D165V	unknown	Het
Cp	T	C	3: 19,978,925	W639R	probably damaging	Het
Cyp7b1	T	A	3: 18,097,221	D276V	possibly damaging	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Erc1	T	A	6: 119,761,272	M509L	probably benign	Het
Evi5l	A	G	8: 4,178,653		probably benign	Het
Exoc6	T	C	19: 37,598,679		probably null	Het
Gm38706	C	T	6: 130,483,781		noncoding transcript	Het
Gpr183	T	C	14: 121,954,921	T63A	possibly damaging	Het
Gpr63	T	A	4: 25,007,952	D225E	probably benign	Het
Grb14	T	A	2: 64,914,734	K93N	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kif28	C	T	1: 179,700,282	G768D	probably damaging	Het
Mro	G	A	18: 73,876,822	S187N	probably benign	Het
Ms4a14	G	T	19: 11,303,057	D712E	possibly damaging	Het
Narfl	A	G	17: 25,776,920		probably benign	Het
Ndufaf1	T	C	2: 119,660,412	T56A	possibly damaging	Het
Nell2	A	T	15: 95,229,210	D761E	probably damaging	Het
Numb	A	G	12: 83,808,205	F116L	probably damaging	Het
Olfr1016	T	C	2: 85,800,148	N41D	probably damaging	Het
Olfr1065	A	G	2: 86,445,316	L222P	probably damaging	Het
Olfr1219	A	G	2: 89,074,735	Y119H	probably damaging	Het
Olfr235	A	T	19: 12,268,409	M60L	possibly damaging	Het
Olfr410	T	A	11: 74,334,980	M84L	probably benign	Het
Olfr798	T	A	10: 129,626,007	D18V	probably damaging	Het
Otog	A	C	7: 46,249,004	N182T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Padi6	A	T	4: 140,731,210	V457E	probably damaging	Het
Pex16	G	A	2: 92,377,530	R109H	possibly damaging	Het
Phactr1	T	C	13: 43,135,219		probably benign	Het
Phf20	G	A	2: 156,267,497	E255K	probably damaging	Het
Pim1	A	G	17: 29,491,483		probably benign	Het
Prr23a2	T	A	9: 98,857,176	Y196N	probably damaging	Het
Prune2	A	T	19: 17,003,659	N60I	probably damaging	Het
Ptprb	T	A	10: 116,353,871	Y1812N	probably damaging	Het
Rab11fip4	A	G	11: 79,690,715	Y512C	possibly damaging	Het
Rft1	T	C	14: 30,666,782	V221A	probably benign	Het
Tacr2	T	C	10: 62,261,497	M252T	probably damaging	Het
Tgfbrap1	A	G	1: 43,075,865	I25T	probably benign	Het
Th	A	G	7: 142,895,440	F191S	probably damaging	Het
Trim3	C	A	7: 105,618,347	R275L	probably benign	Het
Trpm3	A	G	19: 22,885,341		probably null	Het
Wars	A	T	12: 108,882,780	D80E	probably benign	Het
Wdr90	T	A	17: 25,845,598	Y1806F	probably damaging	Het
Zfp644	A	T	5: 106,634,869	I1182N	possibly damaging	Het

Other mutations in Krt79

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Krt79	APN	15	101940166	missense	probably damaging	0.98
IGL00546:Krt79	APN	15	101929873	missense	probably benign	0.00
IGL01595:Krt79	APN	15	101931771	missense	probably damaging	0.98
IGL02193:Krt79	APN	15	101939905	missense	possibly damaging	0.59
R0639:Krt79	UTSW	15	101931548	nonsense	probably null
R0980:Krt79	UTSW	15	101938007	missense	probably damaging	1.00
R1839:Krt79	UTSW	15	101937938	missense	possibly damaging	0.81
R4624:Krt79	UTSW	15	101939806	missense	possibly damaging	0.92
R4745:Krt79	UTSW	15	101930684	missense	probably damaging	1.00
R5203:Krt79	UTSW	15	101929740	missense	unknown
R5568:Krt79	UTSW	15	101929785	missense	probably damaging	0.99
R6902:Krt79	UTSW	15	101931879	missense	probably benign	0.08
R6916:Krt79	UTSW	15	101936170	missense	probably benign	0.01
R6998:Krt79	UTSW	15	101937872	missense	probably benign
R7009:Krt79	UTSW	15	101931441	missense	probably damaging	1.00
R7663:Krt79	UTSW	15	101931843	missense	probably damaging	0.97
R8161:Krt79	UTSW	15	101930702	missense	probably damaging	0.96
R8184:Krt79	UTSW	15	101929752	missense	unknown
R8206:Krt79	UTSW	15	101940270	start gained	probably null
R8705:Krt79	UTSW	15	101938006	missense	probably damaging	1.00
R8993:Krt79	UTSW	15	101931006	intron	probably benign
R9055:Krt79	UTSW	15	101931487	missense	probably damaging	1.00
R9322:Krt79	UTSW	15	101931810	missense	possibly damaging	0.92
R9456:Krt79	UTSW	15	101931469	missense	probably benign	0.02
R9495:Krt79	UTSW	15	101931853	missense	probably damaging	1.00
R9514:Krt79	UTSW	15	101931853	missense	probably damaging	1.00
R9533:Krt79	UTSW	15	101939982	missense	possibly damaging	0.55
R9560:Krt79	UTSW	15	101937842	missense	probably damaging	0.99
R9705:Krt79	UTSW	15	101930761	missense	probably benign
R9706:Krt79	UTSW	15	101930761	missense	probably benign
R9707:Krt79	UTSW	15	101930761	missense	probably benign
R9714:Krt79	UTSW	15	101930761	missense	probably benign
R9750:Krt79	UTSW	15	101930761	missense	probably benign
R9751:Krt79	UTSW	15	101930761	missense	probably benign
R9753:Krt79	UTSW	15	101930761	missense	probably benign
R9772:Krt79	UTSW	15	101930761	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGACATGTCCCTTTGAAAGAGG -3'
(R):5'- ACTCAGCTCTCATGGGACTTAC -3'

Sequencing Primer
(F):5'- GTCCCTTTGAAAGAGGTCATACC -3'
(R):5'- CTCTCATGGGACTTACAGCAGAG -3'

Posted On

2016-08-04