Incidental Mutation 'R5382:Narfl'
ID424812
Institutional Source Beutler Lab
Gene Symbol Narfl
Ensembl Gene ENSMUSG00000002280
Gene Namenuclear prelamin A recognition factor-like
Synonyms
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25773776-25783332 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 25776920 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002350] [ENSMUST00000131458] [ENSMUST00000134108] [ENSMUST00000140738]
Predicted Effect probably benign
Transcript: ENSMUST00000002350
SMART Domains Protein: ENSMUSP00000002350
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 406 8.5e-95 PFAM
Fe_hyd_SSU 410 466 9.56e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130861
Predicted Effect probably benign
Transcript: ENSMUST00000131458
SMART Domains Protein: ENSMUSP00000120281
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
low complexity region 58 73 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134108
SMART Domains Protein: ENSMUSP00000117136
Gene: ENSMUSG00000002280

DomainStartEndE-ValueType
Pfam:Fe_hyd_lg_C 110 422 4e-85 PFAM
Fe_hyd_SSU 426 482 9.56e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140738
SMART Domains Protein: ENSMUSP00000116841
Gene: ENSMUSG00000061046

DomainStartEndE-ValueType
Lactamase_B 11 173 7.63e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183975
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted knock-out die before E10.5. Mice heterozygous for a targeted allele exhibit partial lethality between E10.5 and birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Pim1 A G 17: 29,491,483 probably benign Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Narfl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02166:Narfl APN 17 25780320 missense possibly damaging 0.83
IGL02266:Narfl APN 17 25780326 missense possibly damaging 0.91
IGL02537:Narfl APN 17 25778942 unclassified probably benign
IGL02926:Narfl APN 17 25782154 missense probably benign
napoleon UTSW 17 25782252 makesense probably null
R0097:Narfl UTSW 17 25777002 missense possibly damaging 0.94
R0097:Narfl UTSW 17 25777002 missense possibly damaging 0.94
R0723:Narfl UTSW 17 25781821 missense probably damaging 1.00
R1219:Narfl UTSW 17 25775101 missense probably damaging 1.00
R1370:Narfl UTSW 17 25776988 missense probably benign 0.24
R4737:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4739:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4740:Narfl UTSW 17 25781309 missense probably damaging 1.00
R4747:Narfl UTSW 17 25780353 missense probably benign 0.04
R4826:Narfl UTSW 17 25780332 missense probably damaging 1.00
R5789:Narfl UTSW 17 25781203 missense probably benign
R7275:Narfl UTSW 17 25775134 missense possibly damaging 0.94
R7576:Narfl UTSW 17 25778970 missense probably damaging 1.00
R7615:Narfl UTSW 17 25782129 missense probably benign 0.01
R7706:Narfl UTSW 17 25782252 makesense probably null
R7911:Narfl UTSW 17 25780398 missense probably benign 0.16
R8103:Narfl UTSW 17 25777421 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGAAGTCAAAAGGCTACCTG -3'
(R):5'- TGGCTCACCTTATTAGCATCTAG -3'

Sequencing Primer
(F):5'- CTGAGCAGGGCAGTGGTG -3'
(R):5'- TATTAGCATCTAGAACCTTCCGCAG -3'
Posted On2016-08-04