Incidental Mutation 'R5382:Pim1'
ID424814
Institutional Source Beutler Lab
Gene Symbol Pim1
Ensembl Gene ENSMUSG00000024014
Gene Nameproviral integration site 1
SynonymsPim-1
MMRRC Submission 042957-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5382 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location29490812-29496111 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 29491483 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000024811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024811]
Predicted Effect probably benign
Transcript: ENSMUST00000024811
SMART Domains Protein: ENSMUSP00000024811
Gene: ENSMUSG00000024014

DomainStartEndE-ValueType
low complexity region 1 45 N/A INTRINSIC
low complexity region 52 77 N/A INTRINSIC
S_TKc 122 374 1.88e-69 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181920
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is expressed primarily in B-lymphoid and myeloid cell lines, and is overexpressed in hematopoietic malignancies and in prostate cancer. It plays a role in signal transduction in blood cells, contributing to both cell proliferation and survival, and thus provides a selective advantage in tumorigenesis. Both the human and orthologous mouse genes have been reported to encode two isoforms (with preferential cellular localization) resulting from the use of alternative in-frame translation initiation codons, the upstream non-AUG (CUG) and downstream AUG codons (PMIDs:16186805, 1825810).[provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have abnormally small erythrocytes but are otherwise phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik G T 6: 149,326,460 E335* probably null Het
Acp7 G A 7: 28,615,419 P250S possibly damaging Het
Actn2 T A 13: 12,308,951 M133L probably benign Het
AI314180 A T 4: 58,850,934 M413K probably benign Het
Arhgap32 A T 9: 32,152,010 K105M probably damaging Het
BC034090 A G 1: 155,225,603 V305A probably benign Het
Brd1 G A 15: 88,729,564 T376M probably damaging Het
Cbl C T 9: 44,159,021 A505T probably benign Het
Cga G T 4: 34,904,048 M14I probably benign Het
Cluh T C 11: 74,665,109 probably benign Het
Col14a1 A T 15: 55,362,436 D165V unknown Het
Cp T C 3: 19,978,925 W639R probably damaging Het
Cyp7b1 T A 3: 18,097,221 D276V possibly damaging Het
Dctd C T 8: 48,137,414 probably benign Het
Erc1 T A 6: 119,761,272 M509L probably benign Het
Evi5l A G 8: 4,178,653 probably benign Het
Exoc6 T C 19: 37,598,679 probably null Het
Gm38706 C T 6: 130,483,781 noncoding transcript Het
Gpr183 T C 14: 121,954,921 T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 D225E probably benign Het
Grb14 T A 2: 64,914,734 K93N probably damaging Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Kif28 C T 1: 179,700,282 G768D probably damaging Het
Krt79 A T 15: 101,931,440 D373E probably benign Het
Mro G A 18: 73,876,822 S187N probably benign Het
Ms4a14 G T 19: 11,303,057 D712E possibly damaging Het
Narfl A G 17: 25,776,920 probably benign Het
Ndufaf1 T C 2: 119,660,412 T56A possibly damaging Het
Nell2 A T 15: 95,229,210 D761E probably damaging Het
Numb A G 12: 83,808,205 F116L probably damaging Het
Olfr1016 T C 2: 85,800,148 N41D probably damaging Het
Olfr1065 A G 2: 86,445,316 L222P probably damaging Het
Olfr1219 A G 2: 89,074,735 Y119H probably damaging Het
Olfr235 A T 19: 12,268,409 M60L possibly damaging Het
Olfr410 T A 11: 74,334,980 M84L probably benign Het
Olfr798 T A 10: 129,626,007 D18V probably damaging Het
Otog A C 7: 46,249,004 N182T probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Padi6 A T 4: 140,731,210 V457E probably damaging Het
Pex16 G A 2: 92,377,530 R109H possibly damaging Het
Phactr1 T C 13: 43,135,219 probably benign Het
Phf20 G A 2: 156,267,497 E255K probably damaging Het
Prr23a2 T A 9: 98,857,176 Y196N probably damaging Het
Prune2 A T 19: 17,003,659 N60I probably damaging Het
Ptprb T A 10: 116,353,871 Y1812N probably damaging Het
Rab11fip4 A G 11: 79,690,715 Y512C possibly damaging Het
Rft1 T C 14: 30,666,782 V221A probably benign Het
Tacr2 T C 10: 62,261,497 M252T probably damaging Het
Tgfbrap1 A G 1: 43,075,865 I25T probably benign Het
Th A G 7: 142,895,440 F191S probably damaging Het
Trim3 C A 7: 105,618,347 R275L probably benign Het
Trpm3 A G 19: 22,885,341 probably null Het
Wars A T 12: 108,882,780 D80E probably benign Het
Wdr90 T A 17: 25,845,598 Y1806F probably damaging Het
Zfp644 A T 5: 106,634,869 I1182N possibly damaging Het
Other mutations in Pim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02076:Pim1 APN 17 29493803 missense probably damaging 1.00
IGL02859:Pim1 APN 17 29491935 missense probably damaging 1.00
IGL03170:Pim1 APN 17 29491178 missense possibly damaging 0.87
IGL03182:Pim1 APN 17 29491766 missense possibly damaging 0.63
IGL03191:Pim1 APN 17 29493719 splice site probably benign
R0510:Pim1 UTSW 17 29493909 splice site probably benign
R5872:Pim1 UTSW 17 29493746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTTCCTAGGCAAAGAGAAGG -3'
(R):5'- GCTCACCTTCTTCAACAGGAC -3'

Sequencing Primer
(F):5'- AGAAGGAGCCCCTGGAGTC -3'
(R):5'- CCATTGGGCTGCAGAGTGAG -3'
Posted On2016-08-04