Incidental Mutation 'R5382:Prune2'
ID 424819
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, A330102H22Rik, 6330414G02Rik, Olfaxin
MMRRC Submission 042957-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5382 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 16933482-17201296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 16981023 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 60 (N60I)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087689
AA Change: N60I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: N60I

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224145
Meta Mutation Damage Score 0.8462 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp7 G A 7: 28,314,844 (GRCm39) P250S possibly damaging Het
Actn2 T A 13: 12,323,837 (GRCm39) M133L probably benign Het
Arhgap32 A T 9: 32,063,306 (GRCm39) K105M probably damaging Het
BC034090 A G 1: 155,101,349 (GRCm39) V305A probably benign Het
Brd1 G A 15: 88,613,767 (GRCm39) T376M probably damaging Het
Cbl C T 9: 44,070,318 (GRCm39) A505T probably benign Het
Cga G T 4: 34,904,048 (GRCm39) M14I probably benign Het
Ciao3 A G 17: 25,995,894 (GRCm39) probably benign Het
Cluh T C 11: 74,555,935 (GRCm39) probably benign Het
Col14a1 A T 15: 55,225,832 (GRCm39) D165V unknown Het
Cp T C 3: 20,033,089 (GRCm39) W639R probably damaging Het
Cyp7b1 T A 3: 18,151,385 (GRCm39) D276V possibly damaging Het
Dctd C T 8: 48,590,449 (GRCm39) probably benign Het
Ecpas A T 4: 58,850,934 (GRCm39) M413K probably benign Het
Erc1 T A 6: 119,738,233 (GRCm39) M509L probably benign Het
Evi5l A G 8: 4,228,653 (GRCm39) probably benign Het
Exoc6 T C 19: 37,587,127 (GRCm39) probably null Het
Gm38706 C T 6: 130,460,744 (GRCm39) noncoding transcript Het
Gpr183 T C 14: 122,192,333 (GRCm39) T63A possibly damaging Het
Gpr63 T A 4: 25,007,952 (GRCm39) D225E probably benign Het
Grb14 T A 2: 64,745,078 (GRCm39) K93N probably damaging Het
Igkv4-80 A C 6: 68,993,649 (GRCm39) S81A probably benign Het
Kif28 C T 1: 179,527,847 (GRCm39) G768D probably damaging Het
Krt79 A T 15: 101,839,875 (GRCm39) D373E probably benign Het
Mro G A 18: 74,009,893 (GRCm39) S187N probably benign Het
Ms4a14 G T 19: 11,280,421 (GRCm39) D712E possibly damaging Het
Ndufaf1 T C 2: 119,490,893 (GRCm39) T56A possibly damaging Het
Nell2 A T 15: 95,127,091 (GRCm39) D761E probably damaging Het
Numb A G 12: 83,854,979 (GRCm39) F116L probably damaging Het
Or3a1 T A 11: 74,225,806 (GRCm39) M84L probably benign Het
Or4c114 A G 2: 88,905,079 (GRCm39) Y119H probably damaging Het
Or5an11 A T 19: 12,245,773 (GRCm39) M60L possibly damaging Het
Or6c66 T A 10: 129,461,876 (GRCm39) D18V probably damaging Het
Or8k27 A G 2: 86,275,660 (GRCm39) L222P probably damaging Het
Or9g20 T C 2: 85,630,492 (GRCm39) N41D probably damaging Het
Otog A C 7: 45,898,428 (GRCm39) N182T probably damaging Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Padi6 A T 4: 140,458,521 (GRCm39) V457E probably damaging Het
Pex16 G A 2: 92,207,875 (GRCm39) R109H possibly damaging Het
Phactr1 T C 13: 43,288,695 (GRCm39) probably benign Het
Phf20 G A 2: 156,109,417 (GRCm39) E255K probably damaging Het
Pim1 A G 17: 29,710,457 (GRCm39) probably benign Het
Prr23a2 T A 9: 98,739,229 (GRCm39) Y196N probably damaging Het
Ptprb T A 10: 116,189,776 (GRCm39) Y1812N probably damaging Het
Rab11fip4 A G 11: 79,581,541 (GRCm39) Y512C possibly damaging Het
Resf1 G T 6: 149,227,958 (GRCm39) E335* probably null Het
Rft1 T C 14: 30,388,739 (GRCm39) V221A probably benign Het
Tacr2 T C 10: 62,097,276 (GRCm39) M252T probably damaging Het
Tgfbrap1 A G 1: 43,115,025 (GRCm39) I25T probably benign Het
Th A G 7: 142,449,177 (GRCm39) F191S probably damaging Het
Trim3 C A 7: 105,267,554 (GRCm39) R275L probably benign Het
Trpm3 A G 19: 22,862,705 (GRCm39) probably null Het
Wars1 A T 12: 108,848,706 (GRCm39) D80E probably benign Het
Wdr90 T A 17: 26,064,572 (GRCm39) Y1806F probably damaging Het
Zfp644 A T 5: 106,782,735 (GRCm39) I1182N possibly damaging Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17,145,708 (GRCm39) critical splice donor site probably null
IGL00848:Prune2 APN 19 17,096,482 (GRCm39) missense probably damaging 1.00
IGL00862:Prune2 APN 19 17,096,713 (GRCm39) missense probably benign 0.41
IGL00915:Prune2 APN 19 16,993,617 (GRCm39) missense probably damaging 1.00
IGL01084:Prune2 APN 19 17,095,573 (GRCm39) missense probably benign 0.19
IGL01109:Prune2 APN 19 17,101,243 (GRCm39) missense probably benign 0.03
IGL01372:Prune2 APN 19 17,102,433 (GRCm39) missense probably damaging 1.00
IGL01650:Prune2 APN 19 17,145,656 (GRCm39) missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17,101,267 (GRCm39) missense possibly damaging 0.50
IGL01812:Prune2 APN 19 16,981,141 (GRCm39) missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17,096,002 (GRCm39) missense probably benign 0.00
IGL02195:Prune2 APN 19 17,096,921 (GRCm39) missense probably benign 0.00
IGL02502:Prune2 APN 19 17,101,245 (GRCm39) missense probably benign 0.00
IGL02569:Prune2 APN 19 17,156,223 (GRCm39) missense probably damaging 0.99
IGL02693:Prune2 APN 19 17,101,855 (GRCm39) missense probably benign 0.03
IGL02737:Prune2 APN 19 17,170,775 (GRCm39) nonsense probably null
IGL02794:Prune2 APN 19 17,096,725 (GRCm39) missense probably benign 0.19
IGL02985:Prune2 APN 19 16,993,723 (GRCm39) critical splice donor site probably null
IGL03349:Prune2 APN 19 17,100,710 (GRCm39) missense probably damaging 1.00
3-1:Prune2 UTSW 19 17,102,646 (GRCm39) missense probably benign 0.00
R0060:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17,099,974 (GRCm39) missense probably benign 0.00
R0277:Prune2 UTSW 19 17,098,753 (GRCm39) missense probably damaging 0.99
R0321:Prune2 UTSW 19 17,099,818 (GRCm39) missense probably benign 0.39
R0321:Prune2 UTSW 19 17,098,291 (GRCm39) missense possibly damaging 0.78
R0374:Prune2 UTSW 19 17,098,274 (GRCm39) missense probably benign 0.00
R0380:Prune2 UTSW 19 17,101,371 (GRCm39) missense probably damaging 1.00
R0396:Prune2 UTSW 19 17,100,444 (GRCm39) missense probably benign 0.35
R0408:Prune2 UTSW 19 17,099,674 (GRCm39) missense probably benign 0.00
R0421:Prune2 UTSW 19 17,100,675 (GRCm39) missense probably benign 0.02
R0480:Prune2 UTSW 19 16,984,156 (GRCm39) splice site probably benign
R0531:Prune2 UTSW 19 16,984,117 (GRCm39) missense probably damaging 1.00
R0546:Prune2 UTSW 19 16,998,030 (GRCm39) splice site probably benign
R0554:Prune2 UTSW 19 17,102,582 (GRCm39) nonsense probably null
R0659:Prune2 UTSW 19 17,100,199 (GRCm39) missense probably damaging 1.00
R0699:Prune2 UTSW 19 17,101,319 (GRCm39) missense probably damaging 1.00
R0781:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1110:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1178:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1181:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1337:Prune2 UTSW 19 17,096,971 (GRCm39) missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17,189,681 (GRCm39) missense probably benign 0.40
R1385:Prune2 UTSW 19 17,102,312 (GRCm39) missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17,098,015 (GRCm39) missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17,102,374 (GRCm39) missense probably benign 0.01
R1756:Prune2 UTSW 19 17,101,068 (GRCm39) missense probably benign 0.01
R1765:Prune2 UTSW 19 17,102,962 (GRCm39) missense probably damaging 1.00
R1782:Prune2 UTSW 19 17,099,537 (GRCm39) missense probably benign 0.00
R1817:Prune2 UTSW 19 17,099,445 (GRCm39) missense probably benign 0.00
R1838:Prune2 UTSW 19 17,177,242 (GRCm39) missense probably damaging 1.00
R1851:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1852:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1866:Prune2 UTSW 19 17,100,856 (GRCm39) missense probably damaging 1.00
R1911:Prune2 UTSW 19 17,091,038 (GRCm39) missense probably benign 0.02
R1983:Prune2 UTSW 19 16,998,006 (GRCm39) missense probably damaging 0.97
R2014:Prune2 UTSW 19 17,097,887 (GRCm39) missense probably damaging 1.00
R2066:Prune2 UTSW 19 17,098,042 (GRCm39) missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17,097,109 (GRCm39) missense possibly damaging 0.95
R2111:Prune2 UTSW 19 17,185,602 (GRCm39) missense probably damaging 1.00
R2128:Prune2 UTSW 19 17,099,786 (GRCm39) missense probably benign 0.00
R2165:Prune2 UTSW 19 17,097,546 (GRCm39) missense probably benign 0.19
R2241:Prune2 UTSW 19 17,100,456 (GRCm39) missense probably damaging 0.96
R2278:Prune2 UTSW 19 17,095,919 (GRCm39) missense possibly damaging 0.93
R2504:Prune2 UTSW 19 16,977,400 (GRCm39) missense probably damaging 1.00
R2508:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R3055:Prune2 UTSW 19 17,102,407 (GRCm39) missense probably damaging 0.98
R3086:Prune2 UTSW 19 17,098,777 (GRCm39) missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3105:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3547:Prune2 UTSW 19 17,101,712 (GRCm39) missense probably damaging 0.96
R3702:Prune2 UTSW 19 17,156,235 (GRCm39) missense probably damaging 1.00
R3753:Prune2 UTSW 19 17,102,818 (GRCm39) missense probably benign 0.38
R3933:Prune2 UTSW 19 17,101,318 (GRCm39) missense probably damaging 1.00
R3935:Prune2 UTSW 19 17,177,150 (GRCm39) missense probably damaging 1.00
R4022:Prune2 UTSW 19 16,977,384 (GRCm39) missense probably damaging 1.00
R4042:Prune2 UTSW 19 16,981,190 (GRCm39) critical splice donor site probably null
R4164:Prune2 UTSW 19 16,981,098 (GRCm39) missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17,099,274 (GRCm39) missense probably benign 0.00
R4642:Prune2 UTSW 19 16,998,019 (GRCm39) critical splice donor site probably null
R4661:Prune2 UTSW 19 16,977,387 (GRCm39) missense probably damaging 1.00
R4666:Prune2 UTSW 19 17,097,552 (GRCm39) nonsense probably null
R4823:Prune2 UTSW 19 17,097,868 (GRCm39) missense probably damaging 1.00
R4897:Prune2 UTSW 19 17,099,219 (GRCm39) missense probably benign 0.03
R4922:Prune2 UTSW 19 17,100,116 (GRCm39) missense probably benign 0.00
R4962:Prune2 UTSW 19 17,099,637 (GRCm39) missense probably benign 0.11
R5026:Prune2 UTSW 19 17,176,506 (GRCm39) missense probably damaging 1.00
R5042:Prune2 UTSW 19 17,097,161 (GRCm39) missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17,177,274 (GRCm39) missense probably damaging 1.00
R5133:Prune2 UTSW 19 16,980,995 (GRCm39) missense probably damaging 1.00
R5184:Prune2 UTSW 19 17,193,721 (GRCm39) missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5339:Prune2 UTSW 19 17,098,236 (GRCm39) missense probably damaging 1.00
R5363:Prune2 UTSW 19 17,095,630 (GRCm39) missense probably damaging 1.00
R5436:Prune2 UTSW 19 16,998,007 (GRCm39) missense probably damaging 1.00
R5480:Prune2 UTSW 19 17,098,311 (GRCm39) missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17,095,573 (GRCm39) missense probably benign 0.19
R5678:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5814:Prune2 UTSW 19 16,993,725 (GRCm39) splice site probably null
R5894:Prune2 UTSW 19 17,098,755 (GRCm39) missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17,096,080 (GRCm39) missense probably benign 0.35
R6207:Prune2 UTSW 19 17,095,480 (GRCm39) missense probably damaging 1.00
R6218:Prune2 UTSW 19 17,098,926 (GRCm39) missense probably benign 0.00
R6573:Prune2 UTSW 19 17,098,522 (GRCm39) missense possibly damaging 0.61
R6573:Prune2 UTSW 19 17,098,521 (GRCm39) missense probably damaging 1.00
R6734:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R6805:Prune2 UTSW 19 17,097,954 (GRCm39) missense probably benign
R6837:Prune2 UTSW 19 17,156,292 (GRCm39) missense probably damaging 1.00
R6850:Prune2 UTSW 19 17,099,552 (GRCm39) missense probably benign 0.00
R6858:Prune2 UTSW 19 17,095,470 (GRCm39) missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17,100,592 (GRCm39) missense probably damaging 1.00
R6954:Prune2 UTSW 19 16,977,385 (GRCm39) missense probably damaging 1.00
R7098:Prune2 UTSW 19 17,097,966 (GRCm39) missense probably benign 0.39
R7102:Prune2 UTSW 19 17,098,577 (GRCm39) missense probably benign 0.24
R7246:Prune2 UTSW 19 17,098,732 (GRCm39) missense probably damaging 0.99
R7284:Prune2 UTSW 19 17,097,250 (GRCm39) missense probably damaging 1.00
R7295:Prune2 UTSW 19 17,097,261 (GRCm39) missense probably benign 0.01
R7371:Prune2 UTSW 19 17,096,734 (GRCm39) missense probably benign 0.02
R7651:Prune2 UTSW 19 17,097,772 (GRCm39) missense probably damaging 1.00
R7830:Prune2 UTSW 19 17,100,038 (GRCm39) missense probably benign 0.21
R7872:Prune2 UTSW 19 17,096,798 (GRCm39) missense probably benign 0.05
R7881:Prune2 UTSW 19 17,100,393 (GRCm39) missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17,156,223 (GRCm39) missense probably damaging 0.99
R7969:Prune2 UTSW 19 17,179,034 (GRCm39) missense probably damaging 0.98
R8092:Prune2 UTSW 19 17,097,357 (GRCm39) missense probably damaging 1.00
R8110:Prune2 UTSW 19 17,098,083 (GRCm39) missense probably benign 0.22
R8115:Prune2 UTSW 19 17,101,288 (GRCm39) missense probably benign 0.02
R8129:Prune2 UTSW 19 17,096,200 (GRCm39) missense probably benign 0.01
R8169:Prune2 UTSW 19 17,102,455 (GRCm39) missense probably benign 0.10
R8171:Prune2 UTSW 19 17,097,882 (GRCm39) missense probably damaging 1.00
R8176:Prune2 UTSW 19 17,095,656 (GRCm39) missense probably damaging 1.00
R8200:Prune2 UTSW 19 17,102,337 (GRCm39) missense probably benign 0.01
R8217:Prune2 UTSW 19 17,097,480 (GRCm39) missense probably benign 0.01
R8258:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8259:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8289:Prune2 UTSW 19 17,100,373 (GRCm39) missense probably benign 0.43
R8329:Prune2 UTSW 19 17,098,629 (GRCm39) missense probably benign 0.02
R8342:Prune2 UTSW 19 17,103,027 (GRCm39) missense probably benign 0.01
R8558:Prune2 UTSW 19 17,099,602 (GRCm39) missense probably damaging 0.98
R8732:Prune2 UTSW 19 17,097,769 (GRCm39) missense probably damaging 1.00
R8743:Prune2 UTSW 19 17,096,920 (GRCm39) missense probably benign 0.22
R8769:Prune2 UTSW 19 17,100,442 (GRCm39) missense probably damaging 0.96
R8862:Prune2 UTSW 19 17,097,510 (GRCm39) missense probably benign 0.04
R8936:Prune2 UTSW 19 17,099,199 (GRCm39) missense probably benign 0.24
R9040:Prune2 UTSW 19 17,097,991 (GRCm39) missense probably damaging 1.00
R9084:Prune2 UTSW 19 17,097,741 (GRCm39) missense probably damaging 1.00
R9224:Prune2 UTSW 19 17,097,393 (GRCm39) missense probably damaging 1.00
R9273:Prune2 UTSW 19 17,095,690 (GRCm39) missense possibly damaging 0.74
R9275:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9278:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9290:Prune2 UTSW 19 17,145,691 (GRCm39) missense probably benign 0.41
R9305:Prune2 UTSW 19 17,097,625 (GRCm39) missense probably benign 0.14
R9317:Prune2 UTSW 19 17,099,034 (GRCm39) missense probably benign 0.00
R9354:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R9373:Prune2 UTSW 19 17,099,502 (GRCm39) missense probably benign
R9394:Prune2 UTSW 19 16,981,053 (GRCm39) missense probably damaging 1.00
R9405:Prune2 UTSW 19 17,193,708 (GRCm39) missense probably damaging 0.99
R9476:Prune2 UTSW 19 17,096,706 (GRCm39) missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17,099,794 (GRCm39) missense probably benign 0.00
X0019:Prune2 UTSW 19 17,098,881 (GRCm39) missense probably benign 0.16
X0028:Prune2 UTSW 19 17,100,249 (GRCm39) missense probably damaging 1.00
X0064:Prune2 UTSW 19 17,099,739 (GRCm39) missense probably damaging 1.00
X0066:Prune2 UTSW 19 17,096,154 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAGAAAGCACTCTGTAACTGG -3'
(R):5'- GCTTCCCTCAGGACAAATGC -3'

Sequencing Primer
(F):5'- AGCACTCTGTAACTGGCCTCAG -3'
(R):5'- GAACCTCACGGTGAGTCTTAC -3'
Posted On 2016-08-04