Mutagenetix > Incidental Mutation

Incidental Mutation 'R5382:Exoc6'

424821

Institutional Source

Beutler Lab

Gene Symbol

Exoc6

Ensembl Gene

ENSMUSG00000053799

Gene Name

exocyst complex component 6

Synonyms

msec15, Sec15l1, 4833405E05Rik, Sec15, hbd

MMRRC Submission

042957-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5382 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

37550418-37683245 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 37598679 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000064332 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066439]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000066439

SMART Domains

Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799

Domain	Start	End	E-Value	Type
low complexity region	265	273	N/A	INTRINSIC
Pfam:Sec15	456	762	8.1e-109	PFAM

Meta Mutation Damage Score

0.9498

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810474O19Rik	G	T	6: 149,326,460	E335*	probably null	Het
Acp7	G	A	7: 28,615,419	P250S	possibly damaging	Het
Actn2	T	A	13: 12,308,951	M133L	probably benign	Het
AI314180	A	T	4: 58,850,934	M413K	probably benign	Het
Arhgap32	A	T	9: 32,152,010	K105M	probably damaging	Het
BC034090	A	G	1: 155,225,603	V305A	probably benign	Het
Brd1	G	A	15: 88,729,564	T376M	probably damaging	Het
Cbl	C	T	9: 44,159,021	A505T	probably benign	Het
Cga	G	T	4: 34,904,048	M14I	probably benign	Het
Cluh	T	C	11: 74,665,109		probably benign	Het
Col14a1	A	T	15: 55,362,436	D165V	unknown	Het
Cp	T	C	3: 19,978,925	W639R	probably damaging	Het
Cyp7b1	T	A	3: 18,097,221	D276V	possibly damaging	Het
Dctd	C	T	8: 48,137,414		probably benign	Het
Erc1	T	A	6: 119,761,272	M509L	probably benign	Het
Evi5l	A	G	8: 4,178,653		probably benign	Het
Gm38706	C	T	6: 130,483,781		noncoding transcript	Het
Gpr183	T	C	14: 121,954,921	T63A	possibly damaging	Het
Gpr63	T	A	4: 25,007,952	D225E	probably benign	Het
Grb14	T	A	2: 64,914,734	K93N	probably damaging	Het
Igkv4-80	A	C	6: 69,016,665	S81A	probably benign	Het
Kif28	C	T	1: 179,700,282	G768D	probably damaging	Het
Krt79	A	T	15: 101,931,440	D373E	probably benign	Het
Mro	G	A	18: 73,876,822	S187N	probably benign	Het
Ms4a14	G	T	19: 11,303,057	D712E	possibly damaging	Het
Narfl	A	G	17: 25,776,920		probably benign	Het
Ndufaf1	T	C	2: 119,660,412	T56A	possibly damaging	Het
Nell2	A	T	15: 95,229,210	D761E	probably damaging	Het
Numb	A	G	12: 83,808,205	F116L	probably damaging	Het
Olfr1016	T	C	2: 85,800,148	N41D	probably damaging	Het
Olfr1065	A	G	2: 86,445,316	L222P	probably damaging	Het
Olfr1219	A	G	2: 89,074,735	Y119H	probably damaging	Het
Olfr235	A	T	19: 12,268,409	M60L	possibly damaging	Het
Olfr410	T	A	11: 74,334,980	M84L	probably benign	Het
Olfr798	T	A	10: 129,626,007	D18V	probably damaging	Het
Otog	A	C	7: 46,249,004	N182T	probably damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Padi6	A	T	4: 140,731,210	V457E	probably damaging	Het
Pex16	G	A	2: 92,377,530	R109H	possibly damaging	Het
Phactr1	T	C	13: 43,135,219		probably benign	Het
Phf20	G	A	2: 156,267,497	E255K	probably damaging	Het
Pim1	A	G	17: 29,491,483		probably benign	Het
Prr23a2	T	A	9: 98,857,176	Y196N	probably damaging	Het
Prune2	A	T	19: 17,003,659	N60I	probably damaging	Het
Ptprb	T	A	10: 116,353,871	Y1812N	probably damaging	Het
Rab11fip4	A	G	11: 79,690,715	Y512C	possibly damaging	Het
Rft1	T	C	14: 30,666,782	V221A	probably benign	Het
Tacr2	T	C	10: 62,261,497	M252T	probably damaging	Het
Tgfbrap1	A	G	1: 43,075,865	I25T	probably benign	Het
Th	A	G	7: 142,895,440	F191S	probably damaging	Het
Trim3	C	A	7: 105,618,347	R275L	probably benign	Het
Trpm3	A	G	19: 22,885,341		probably null	Het
Wars	A	T	12: 108,882,780	D80E	probably benign	Het
Wdr90	T	A	17: 25,845,598	Y1806F	probably damaging	Het
Zfp644	A	T	5: 106,634,869	I1182N	possibly damaging	Het

Other mutations in Exoc6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01432:Exoc6	APN	19	37589876	missense	possibly damaging	0.68
IGL01716:Exoc6	APN	19	37682964	missense	probably damaging	0.98
IGL02363:Exoc6	APN	19	37608954	missense	probably damaging	1.00
IGL02383:Exoc6	APN	19	37578474	missense	probably benign
IGL03394:Exoc6	APN	19	37599572	missense	probably benign	0.15
australamerican	UTSW	19	37598679	critical splice donor site	probably null
IGL03046:Exoc6	UTSW	19	37593769	critical splice donor site	probably null
R1156:Exoc6	UTSW	19	37682897	missense	probably benign	0.05
R1489:Exoc6	UTSW	19	37597120	missense	possibly damaging	0.71
R1747:Exoc6	UTSW	19	37639769	splice site	probably null
R2125:Exoc6	UTSW	19	37590941	missense	probably damaging	1.00
R2863:Exoc6	UTSW	19	37653413	missense	probably benign	0.34
R4090:Exoc6	UTSW	19	37571912	missense	probably benign
R4666:Exoc6	UTSW	19	37570505	missense	probably damaging	0.97
R4674:Exoc6	UTSW	19	37609082	missense	probably damaging	1.00
R5471:Exoc6	UTSW	19	37599617	missense	probably benign	0.30
R5533:Exoc6	UTSW	19	37593770	splice site	probably null
R5607:Exoc6	UTSW	19	37578529	missense	probably benign	0.01
R5641:Exoc6	UTSW	19	37587633	splice site	probably null
R5759:Exoc6	UTSW	19	37573741	nonsense	probably null
R5889:Exoc6	UTSW	19	37582245	missense	probably damaging	1.00
R6592:Exoc6	UTSW	19	37571912	missense	probably benign
R6936:Exoc6	UTSW	19	37571863	missense	probably benign	0.00
R6988:Exoc6	UTSW	19	37609091	missense	probably damaging	1.00
R7088:Exoc6	UTSW	19	37577010	missense	probably damaging	0.99
R7162:Exoc6	UTSW	19	37577118	missense	probably damaging	0.97
R7948:Exoc6	UTSW	19	37576974	missense	probably benign	0.00
R8266:Exoc6	UTSW	19	37577049	missense	probably benign	0.00
R8525:Exoc6	UTSW	19	37608992	missense	possibly damaging	0.53
R8917:Exoc6	UTSW	19	37589912	missense	probably benign	0.35
R9003:Exoc6	UTSW	19	37598649	missense	probably damaging	1.00
R9159:Exoc6	UTSW	19	37609030	missense	probably benign	0.00
R9435:Exoc6	UTSW	19	37597097	missense	probably benign	0.00
R9459:Exoc6	UTSW	19	37585893	missense	probably benign	0.00
R9527:Exoc6	UTSW	19	37570539	missense	probably benign	0.26
R9563:Exoc6	UTSW	19	37599623	missense	probably damaging	1.00
R9730:Exoc6	UTSW	19	37599584	missense	probably benign	0.02
RF009:Exoc6	UTSW	19	37571620	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTAGCTTAATGAGTCACTGCC -3'
(R):5'- TGCAAAGCTAGCTCTACAGGATAATAC -3'

Sequencing Primer
(F):5'- GTCACTGCCATTTATAAAGAata -3'
(R):5'- GCAAGACATGTGTAGTGTGCC -3'

Posted On

2016-08-04