Incidental Mutation 'R5383:Sp110'
ID424824
Institutional Source Beutler Lab
Gene Symbol Sp110
Ensembl Gene ENSMUSG00000070034
Gene NameSp110 nuclear body protein
Synonyms5830484A20Rik, Ipr1, Ifi75, 5031415C07Rik, 52kDa
MMRRC Submission 042958-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.409) question?
Stock #R5383 (G1)
Quality Score217
Status Not validated
Chromosome1
Chromosomal Location85576899-85598817 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TC to TCC at 85591569 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091226 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508]
PDB Structure
Solution structure of the SAND domain of the putative nuclear protein homolog (5830484A20Rik) [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151690
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152399
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 8,992,700 Y227F possibly damaging Het
4921501E09Rik T C 17: 33,065,257 D857G probably benign Het
Aadac T C 3: 60,036,075 probably benign Het
Abl2 G A 1: 156,642,232 G918E possibly damaging Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Adck1 T C 12: 88,455,603 V328A probably benign Het
Ano6 A G 15: 95,916,037 I279V probably benign Het
AW551984 T A 9: 39,590,698 Y704F probably benign Het
C1s1 T C 6: 124,534,401 D321G probably damaging Het
Cacna1d T A 14: 30,045,279 D1910V possibly damaging Het
Ccdc129 T A 6: 55,978,290 L961H probably benign Het
Cdh5 A G 8: 104,137,847 Q480R probably benign Het
Cdhr1 C T 14: 37,089,007 V266M possibly damaging Het
Cdk5rap1 A T 2: 154,350,835 V414D possibly damaging Het
Ctdnep1 T A 11: 69,984,396 probably benign Het
Cyfip2 T C 11: 46,278,091 M212V possibly damaging Het
D130043K22Rik G A 13: 24,857,414 S273N probably benign Het
Ddi2 A G 4: 141,684,852 S250P probably damaging Het
Dennd1b A G 1: 139,167,671 T486A probably benign Het
Disc1 A G 8: 125,135,457 T523A probably damaging Het
Dmbx1 A G 4: 115,918,145 S313P probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnah11 T C 12: 118,085,697 E1664G probably damaging Het
Dpysl3 A T 18: 43,438,038 V57E probably damaging Het
Fam98a C T 17: 75,538,581 G390E unknown Het
Hook3 C A 8: 26,118,989 R9L probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Impg2 A G 16: 56,243,626 D298G probably benign Het
Inf2 T A 12: 112,600,145 V48D probably damaging Het
Kcnh1 G A 1: 192,505,691 G820D probably benign Het
Lsm14a C T 7: 34,389,364 A39T possibly damaging Het
Muc2 T C 7: 141,753,719 C804R probably damaging Het
Nim1k C T 13: 119,727,799 V25M probably benign Het
Olfr1246 T C 2: 89,591,113 M1V probably null Het
Olfr1484 T A 19: 13,586,075 M257K probably damaging Het
Olfr741 T A 14: 50,486,052 L198* probably null Het
Olfr780 A G 10: 129,322,336 T238A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pitrm1 T A 13: 6,577,432 H856Q probably damaging Het
Pkd1 T C 17: 24,574,375 C1679R probably benign Het
Pkp4 T A 2: 59,310,273 L441* probably null Het
Ppp4r4 T C 12: 103,584,168 F284L probably benign Het
Ptprt T A 2: 161,698,049 K769M probably damaging Het
Rbm12 G T 2: 156,103,365 probably benign Het
Rpf1 T C 3: 146,519,391 D94G possibly damaging Het
Scap G T 9: 110,374,529 K310N probably damaging Het
Smpd2 C T 10: 41,488,702 probably benign Het
Specc1l T A 10: 75,246,705 I662N possibly damaging Het
Sptan1 T A 2: 30,011,328 V1496D probably damaging Het
Srrm4 T C 5: 116,471,260 probably benign Het
Taf2 A G 15: 55,049,419 I515T possibly damaging Het
Tdrd3 C T 14: 87,480,791 Q203* probably null Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Tmem43 G A 6: 91,473,890 A2T probably benign Het
Trav9-1 T A 14: 53,488,376 I49N probably benign Het
Trim23 T G 13: 104,198,697 N410K probably damaging Het
Ttbk1 T C 17: 46,467,416 T567A probably damaging Het
Unc79 A G 12: 103,104,627 N1081S possibly damaging Het
Zfp451 A C 1: 33,813,806 I9R probably damaging Het
Zfp563 T A 17: 33,104,707 M92K probably benign Het
Zfp618 G A 4: 63,095,492 G198D probably benign Het
Zfp637 G T 6: 117,843,309 probably benign Het
Other mutations in Sp110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Sp110 APN 1 85577329 missense probably benign
IGL00510:Sp110 APN 1 85577329 missense probably benign
IGL00516:Sp110 APN 1 85577329 missense probably benign
IGL00990:Sp110 APN 1 85586281 missense possibly damaging 0.51
IGL03382:Sp110 APN 1 85577329 missense probably benign
FR4342:Sp110 UTSW 1 85587488 small insertion probably benign
FR4976:Sp110 UTSW 1 85587489 small insertion probably benign
IGL03147:Sp110 UTSW 1 85591567 frame shift probably null
PIT4131001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4131001:Sp110 UTSW 1 85586254 missense probably benign 0.01
PIT4142001:Sp110 UTSW 1 85586250 missense probably benign 0.05
PIT4142001:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0472:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R0483:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R0551:Sp110 UTSW 1 85589100 splice site probably benign
R0638:Sp110 UTSW 1 85577329 missense probably benign
R0806:Sp110 UTSW 1 85586254 missense probably benign 0.01
R0806:Sp110 UTSW 1 85586281 missense possibly damaging 0.51
R1074:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1079:Sp110 UTSW 1 85589104 splice site probably benign
R1228:Sp110 UTSW 1 85591760 missense probably benign 0.03
R1403:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1406:Sp110 UTSW 1 85579079 missense probably benign 0.00
R1418:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1718:Sp110 UTSW 1 85594385 missense probably benign 0.08
R1744:Sp110 UTSW 1 85594372 missense probably benign 0.26
R1747:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R1806:Sp110 UTSW 1 85596110 critical splice acceptor site probably null
R1957:Sp110 UTSW 1 85577329 missense probably benign
R2404:Sp110 UTSW 1 85577329 missense probably benign
R2964:Sp110 UTSW 1 85577329 missense probably benign
R3176:Sp110 UTSW 1 85577329 missense probably benign
R4190:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4398:Sp110 UTSW 1 85577329 missense probably benign
R4505:Sp110 UTSW 1 85589173 missense probably damaging 1.00
R4565:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4625:Sp110 UTSW 1 85577329 missense probably benign
R4922:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R4986:Sp110 UTSW 1 85591760 missense probably benign 0.03
R5014:Sp110 UTSW 1 85577329 missense probably benign
R5080:Sp110 UTSW 1 85596055 nonsense probably null
R5087:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5254:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5335:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5353:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5387:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5389:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5398:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5443:Sp110 UTSW 1 85589120 missense possibly damaging 0.79
R5447:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5729:Sp110 UTSW 1 85589118 missense probably damaging 0.99
R5752:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5754:Sp110 UTSW 1 85577202 utr 3 prime probably benign
R5799:Sp110 UTSW 1 85577329 missense probably benign
R6027:Sp110 UTSW 1 85577318 missense possibly damaging 0.83
R6171:Sp110 UTSW 1 85577329 missense probably benign
R6367:Sp110 UTSW 1 85594292 missense probably benign 0.00
R6771:Sp110 UTSW 1 85592279 intron probably null
R7097:Sp110 UTSW 1 85579685 missense possibly damaging 0.80
R7519:Sp110 UTSW 1 85579092 missense
R7520:Sp110 UTSW 1 85579092 missense
R7594:Sp110 UTSW 1 85579092 missense
R7596:Sp110 UTSW 1 85579092 missense
R7598:Sp110 UTSW 1 85579092 missense
R7600:Sp110 UTSW 1 85579092 missense
R7601:Sp110 UTSW 1 85579092 missense
R7602:Sp110 UTSW 1 85579092 missense
R7640:Sp110 UTSW 1 85579092 missense
R7641:Sp110 UTSW 1 85579092 missense
R7674:Sp110 UTSW 1 85579092 missense
R7691:Sp110 UTSW 1 85579092 missense
R7695:Sp110 UTSW 1 85579092 missense
R8072:Sp110 UTSW 1 85587486 small insertion probably benign
X0035:Sp110 UTSW 1 85586254 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCGCTTGTGATTTTCTTAGAGAG -3'
(R):5'- TAGGCAATCCTGTCTGCCAG -3'

Sequencing Primer
(F):5'- CTTGTGATTTTCTTAGAGAGGGTTG -3'
(R):5'- CCAGTTGGTTATACCTACGAAGAG -3'
Posted On2016-08-04