Incidental Mutation 'R5383:Zfp618'
ID424836
Institutional Source Beutler Lab
Gene Symbol Zfp618
Ensembl Gene ENSMUSG00000028358
Gene Namezinc finger protein 618
SynonymsD430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
MMRRC Submission 042958-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R5383 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location62965573-63139708 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 63095492 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 198 (G198D)
Ref Sequence ENSEMBL: ENSMUSP00000069275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030043] [ENSMUST00000064814] [ENSMUST00000107415]
Predicted Effect probably benign
Transcript: ENSMUST00000030043
AA Change: G174D

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030043
Gene: ENSMUSG00000028358
AA Change: G174D

DomainStartEndE-ValueType
ZnF_C2H2 90 112 5.06e-2 SMART
ZnF_C2H2 131 153 8.81e-2 SMART
ZnF_C2H2 199 221 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064814
AA Change: G198D

PolyPhen 2 Score 0.329 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069275
Gene: ENSMUSG00000028358
AA Change: G198D

DomainStartEndE-ValueType
ZnF_C2H2 114 136 5.06e-2 SMART
ZnF_C2H2 155 177 8.81e-2 SMART
ZnF_C2H2 243 265 2.91e-2 SMART
low complexity region 288 295 N/A INTRINSIC
ZnF_C2H2 298 320 2.53e-2 SMART
PDB:2BW3|A 377 690 5e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000107415
AA Change: G230D

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000103038
Gene: ENSMUSG00000028358
AA Change: G230D

DomainStartEndE-ValueType
ZnF_C2H2 146 168 5.06e-2 SMART
ZnF_C2H2 187 209 8.81e-2 SMART
ZnF_C2H2 255 277 2.91e-2 SMART
low complexity region 381 388 N/A INTRINSIC
ZnF_C2H2 391 413 2.53e-2 SMART
PDB:2BW3|A 479 783 9e-8 PDB
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 8,992,700 Y227F possibly damaging Het
4921501E09Rik T C 17: 33,065,257 D857G probably benign Het
Aadac T C 3: 60,036,075 probably benign Het
Abl2 G A 1: 156,642,232 G918E possibly damaging Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Adck1 T C 12: 88,455,603 V328A probably benign Het
Ano6 A G 15: 95,916,037 I279V probably benign Het
AW551984 T A 9: 39,590,698 Y704F probably benign Het
C1s1 T C 6: 124,534,401 D321G probably damaging Het
Cacna1d T A 14: 30,045,279 D1910V possibly damaging Het
Ccdc129 T A 6: 55,978,290 L961H probably benign Het
Cdh5 A G 8: 104,137,847 Q480R probably benign Het
Cdhr1 C T 14: 37,089,007 V266M possibly damaging Het
Cdk5rap1 A T 2: 154,350,835 V414D possibly damaging Het
Ctdnep1 T A 11: 69,984,396 probably benign Het
Cyfip2 T C 11: 46,278,091 M212V possibly damaging Het
D130043K22Rik G A 13: 24,857,414 S273N probably benign Het
Ddi2 A G 4: 141,684,852 S250P probably damaging Het
Dennd1b A G 1: 139,167,671 T486A probably benign Het
Disc1 A G 8: 125,135,457 T523A probably damaging Het
Dmbx1 A G 4: 115,918,145 S313P probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnah11 T C 12: 118,085,697 E1664G probably damaging Het
Dpysl3 A T 18: 43,438,038 V57E probably damaging Het
Fam98a C T 17: 75,538,581 G390E unknown Het
Hook3 C A 8: 26,118,989 R9L probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Impg2 A G 16: 56,243,626 D298G probably benign Het
Inf2 T A 12: 112,600,145 V48D probably damaging Het
Kcnh1 G A 1: 192,505,691 G820D probably benign Het
Lsm14a C T 7: 34,389,364 A39T possibly damaging Het
Muc2 T C 7: 141,753,719 C804R probably damaging Het
Nim1k C T 13: 119,727,799 V25M probably benign Het
Olfr1246 T C 2: 89,591,113 M1V probably null Het
Olfr1484 T A 19: 13,586,075 M257K probably damaging Het
Olfr741 T A 14: 50,486,052 L198* probably null Het
Olfr780 A G 10: 129,322,336 T238A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pitrm1 T A 13: 6,577,432 H856Q probably damaging Het
Pkd1 T C 17: 24,574,375 C1679R probably benign Het
Pkp4 T A 2: 59,310,273 L441* probably null Het
Ppp4r4 T C 12: 103,584,168 F284L probably benign Het
Ptprt T A 2: 161,698,049 K769M probably damaging Het
Rbm12 G T 2: 156,103,365 probably benign Het
Rpf1 T C 3: 146,519,391 D94G possibly damaging Het
Scap G T 9: 110,374,529 K310N probably damaging Het
Smpd2 C T 10: 41,488,702 probably benign Het
Sp110 TC TCC 1: 85,591,569 probably null Het
Specc1l T A 10: 75,246,705 I662N possibly damaging Het
Sptan1 T A 2: 30,011,328 V1496D probably damaging Het
Srrm4 T C 5: 116,471,260 probably benign Het
Taf2 A G 15: 55,049,419 I515T possibly damaging Het
Tdrd3 C T 14: 87,480,791 Q203* probably null Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Tmem43 G A 6: 91,473,890 A2T probably benign Het
Trav9-1 T A 14: 53,488,376 I49N probably benign Het
Trim23 T G 13: 104,198,697 N410K probably damaging Het
Ttbk1 T C 17: 46,467,416 T567A probably damaging Het
Unc79 A G 12: 103,104,627 N1081S possibly damaging Het
Zfp451 A C 1: 33,813,806 I9R probably damaging Het
Zfp563 T A 17: 33,104,707 M92K probably benign Het
Zfp637 G T 6: 117,843,309 probably benign Het
Other mutations in Zfp618
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Zfp618 APN 4 63132826 missense probably damaging 1.00
IGL01563:Zfp618 APN 4 63079896 missense probably benign 0.38
IGL01726:Zfp618 APN 4 63132635 missense probably damaging 1.00
IGL02139:Zfp618 APN 4 63133536 missense probably damaging 1.00
IGL02182:Zfp618 APN 4 63095561 splice site probably benign
IGL02533:Zfp618 APN 4 63089405 missense probably damaging 1.00
IGL03231:Zfp618 APN 4 63094479 missense probably damaging 1.00
IGL03257:Zfp618 APN 4 63132671 missense probably damaging 1.00
ANU18:Zfp618 UTSW 4 63132826 missense probably damaging 1.00
IGL03014:Zfp618 UTSW 4 63080088 missense probably damaging 1.00
R0288:Zfp618 UTSW 4 63132934 missense possibly damaging 0.57
R0408:Zfp618 UTSW 4 63086572 missense probably damaging 0.97
R0685:Zfp618 UTSW 4 63133774 missense probably benign 0.21
R1482:Zfp618 UTSW 4 63115448 missense possibly damaging 0.64
R1585:Zfp618 UTSW 4 63132938 missense probably damaging 1.00
R1649:Zfp618 UTSW 4 63095537 missense probably damaging 1.00
R1744:Zfp618 UTSW 4 63086634 splice site probably benign
R1793:Zfp618 UTSW 4 63133237 missense probably damaging 0.97
R1952:Zfp618 UTSW 4 63132318 splice site probably null
R1996:Zfp618 UTSW 4 63131215 splice site probably null
R3792:Zfp618 UTSW 4 63115491 intron probably benign
R3803:Zfp618 UTSW 4 63133019 missense probably damaging 1.00
R3821:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R3838:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4009:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4010:Zfp618 UTSW 4 63133564 missense probably benign 0.00
R4565:Zfp618 UTSW 4 63121351 missense probably damaging 1.00
R4611:Zfp618 UTSW 4 63132979 missense probably damaging 1.00
R5019:Zfp618 UTSW 4 63103552 missense probably damaging 1.00
R5154:Zfp618 UTSW 4 63133209 missense probably damaging 1.00
R5183:Zfp618 UTSW 4 63099282 missense probably benign
R5354:Zfp618 UTSW 4 63080028 missense probably damaging 1.00
R5774:Zfp618 UTSW 4 63132562 missense probably damaging 1.00
R5932:Zfp618 UTSW 4 63118566 nonsense probably null
R6101:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6105:Zfp618 UTSW 4 63133241 missense probably benign 0.09
R6478:Zfp618 UTSW 4 63132706 missense probably damaging 1.00
R6598:Zfp618 UTSW 4 63089399 missense probably damaging 1.00
R7386:Zfp618 UTSW 4 63095385 critical splice donor site probably null
R7666:Zfp618 UTSW 4 63132717 nonsense probably null
R7678:Zfp618 UTSW 4 63086621 missense probably benign 0.07
X0011:Zfp618 UTSW 4 63080006 missense probably damaging 0.99
Z1176:Zfp618 UTSW 4 63095497 missense probably benign 0.29
Z1176:Zfp618 UTSW 4 63132763 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGGGACTCACAGGACTCTTG -3'
(R):5'- ACTACCGTGACCTTGACCAC -3'

Sequencing Primer
(F):5'- ACTCACAGGACTCTTGTTTGTTTTG -3'
(R):5'- GTGACCTTGACCACACCCTG -3'
Posted On2016-08-04