Incidental Mutation 'R5383:Dmbx1'
ID424837
Institutional Source Beutler Lab
Gene Symbol Dmbx1
Ensembl Gene ENSMUSG00000028707
Gene Namediencephalon/mesencephalon homeobox 1
SynonymsAtx, Cdmx, Dmbx1, Mbx, Otx3
MMRRC Submission 042958-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R5383 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115915119-115939926 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115918145 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 313 (S313P)
Ref Sequence ENSEMBL: ENSMUSP00000120320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064806] [ENSMUST00000084338] [ENSMUST00000124071]
Predicted Effect probably damaging
Transcript: ENSMUST00000064806
AA Change: S313P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134457
Gene: ENSMUSG00000028707
AA Change: S313P

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084338
AA Change: S318P

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000081366
Gene: ENSMUSG00000028707
AA Change: S318P

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 71 133 6.07e-26 SMART
low complexity region 177 192 N/A INTRINSIC
low complexity region 240 261 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
Pfam:OAR 355 372 3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124071
AA Change: S313P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120320
Gene: ENSMUSG00000028707
AA Change: S313P

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
HOX 66 128 6.07e-26 SMART
low complexity region 172 187 N/A INTRINSIC
low complexity region 235 256 N/A INTRINSIC
low complexity region 284 295 N/A INTRINSIC
low complexity region 330 348 N/A INTRINSIC
Pfam:OAR 349 368 9.2e-9 PFAM
Meta Mutation Damage Score 0.0686 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bicoid sub-family of homeodomain-containing transcription factors. The encoded protein acts as a transcription factor and may play a role in brain and sensory organ development. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one null allele display partial postnatal lethality, impaired suckling and postnatal growth, and reduced female fertility. When raised in isolation, mice homozygous for another null allele exhibit decreased body weight, decreased food consumption, and small adipocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 8,992,700 Y227F possibly damaging Het
4921501E09Rik T C 17: 33,065,257 D857G probably benign Het
Aadac T C 3: 60,036,075 probably benign Het
Abl2 G A 1: 156,642,232 G918E possibly damaging Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Adck1 T C 12: 88,455,603 V328A probably benign Het
Ano6 A G 15: 95,916,037 I279V probably benign Het
AW551984 T A 9: 39,590,698 Y704F probably benign Het
C1s1 T C 6: 124,534,401 D321G probably damaging Het
Cacna1d T A 14: 30,045,279 D1910V possibly damaging Het
Ccdc129 T A 6: 55,978,290 L961H probably benign Het
Cdh5 A G 8: 104,137,847 Q480R probably benign Het
Cdhr1 C T 14: 37,089,007 V266M possibly damaging Het
Cdk5rap1 A T 2: 154,350,835 V414D possibly damaging Het
Ctdnep1 T A 11: 69,984,396 probably benign Het
Cyfip2 T C 11: 46,278,091 M212V possibly damaging Het
D130043K22Rik G A 13: 24,857,414 S273N probably benign Het
Ddi2 A G 4: 141,684,852 S250P probably damaging Het
Dennd1b A G 1: 139,167,671 T486A probably benign Het
Disc1 A G 8: 125,135,457 T523A probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnah11 T C 12: 118,085,697 E1664G probably damaging Het
Dpysl3 A T 18: 43,438,038 V57E probably damaging Het
Fam98a C T 17: 75,538,581 G390E unknown Het
Hook3 C A 8: 26,118,989 R9L probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Impg2 A G 16: 56,243,626 D298G probably benign Het
Inf2 T A 12: 112,600,145 V48D probably damaging Het
Kcnh1 G A 1: 192,505,691 G820D probably benign Het
Lsm14a C T 7: 34,389,364 A39T possibly damaging Het
Muc2 T C 7: 141,753,719 C804R probably damaging Het
Nim1k C T 13: 119,727,799 V25M probably benign Het
Olfr1246 T C 2: 89,591,113 M1V probably null Het
Olfr1484 T A 19: 13,586,075 M257K probably damaging Het
Olfr741 T A 14: 50,486,052 L198* probably null Het
Olfr780 A G 10: 129,322,336 T238A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pitrm1 T A 13: 6,577,432 H856Q probably damaging Het
Pkd1 T C 17: 24,574,375 C1679R probably benign Het
Pkp4 T A 2: 59,310,273 L441* probably null Het
Ppp4r4 T C 12: 103,584,168 F284L probably benign Het
Ptprt T A 2: 161,698,049 K769M probably damaging Het
Rbm12 G T 2: 156,103,365 probably benign Het
Rpf1 T C 3: 146,519,391 D94G possibly damaging Het
Scap G T 9: 110,374,529 K310N probably damaging Het
Smpd2 C T 10: 41,488,702 probably benign Het
Sp110 TC TCC 1: 85,591,569 probably null Het
Specc1l T A 10: 75,246,705 I662N possibly damaging Het
Sptan1 T A 2: 30,011,328 V1496D probably damaging Het
Srrm4 T C 5: 116,471,260 probably benign Het
Taf2 A G 15: 55,049,419 I515T possibly damaging Het
Tdrd3 C T 14: 87,480,791 Q203* probably null Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Tmem43 G A 6: 91,473,890 A2T probably benign Het
Trav9-1 T A 14: 53,488,376 I49N probably benign Het
Trim23 T G 13: 104,198,697 N410K probably damaging Het
Ttbk1 T C 17: 46,467,416 T567A probably damaging Het
Unc79 A G 12: 103,104,627 N1081S possibly damaging Het
Zfp451 A C 1: 33,813,806 I9R probably damaging Het
Zfp563 T A 17: 33,104,707 M92K probably benign Het
Zfp618 G A 4: 63,095,492 G198D probably benign Het
Zfp637 G T 6: 117,843,309 probably benign Het
Other mutations in Dmbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Dmbx1 APN 4 115920006 missense probably benign 0.00
IGL02850:Dmbx1 APN 4 115918007 missense probably damaging 1.00
R0014:Dmbx1 UTSW 4 115918024 missense probably damaging 0.99
R0014:Dmbx1 UTSW 4 115918024 missense probably damaging 0.99
R0267:Dmbx1 UTSW 4 115918112 missense probably benign 0.41
R1164:Dmbx1 UTSW 4 115918258 missense probably damaging 1.00
R2567:Dmbx1 UTSW 4 115920292 missense probably damaging 1.00
R3419:Dmbx1 UTSW 4 115920676 missense probably benign 0.21
R5882:Dmbx1 UTSW 4 115920301 missense probably damaging 1.00
R5999:Dmbx1 UTSW 4 115918176 missense probably damaging 0.98
R7064:Dmbx1 UTSW 4 115918268 missense probably damaging 1.00
R7483:Dmbx1 UTSW 4 115923711 missense probably damaging 1.00
R7829:Dmbx1 UTSW 4 115923907 intron probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTATCGAGTCCCAGGGATG -3'
(R):5'- TCTGCTTGCAGATTCCCCAG -3'

Sequencing Primer
(F):5'- AGGGATGCGGCGTGCTG -3'
(R):5'- TGCAGATTCCCCAGGCAGC -3'
Posted On2016-08-04