Incidental Mutation 'R5383:Tmem43'
ID424842
Institutional Source Beutler Lab
Gene Symbol Tmem43
Ensembl Gene ENSMUSG00000030095
Gene Nametransmembrane protein 43
Synonyms1200015A22Rik, LUMA
MMRRC Submission 042958-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5383 (G1)
Quality Score208
Status Validated
Chromosome6
Chromosomal Location91473703-91488463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 91473890 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 2 (A2T)
Ref Sequence ENSEMBL: ENSMUSP00000032183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032183] [ENSMUST00000040835]
Predicted Effect probably benign
Transcript: ENSMUST00000032183
AA Change: A2T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032183
Gene: ENSMUSG00000030095
AA Change: A2T

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:DUF1625 121 373 3.6e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000040835
SMART Domains Protein: ENSMUSP00000041380
Gene: ENSMUSG00000034203

DomainStartEndE-ValueType
Pfam:CHCH 64 100 8.4e-12 PFAM
low complexity region 109 123 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205802
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205954
Meta Mutation Damage Score 0.1048 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TMEM43 family. Defects in this gene are the cause of familial arrhythmogenic right ventricular dysplasia type 5 (ARVD5), also known as arrhythmogenic right ventricular cardiomyopathy type 5 (ARVC5). Arrhythmogenic right ventricular dysplasia is an inherited disorder, often involving both ventricles, and is characterized by ventricular tachycardia, heart failure, sudden cardiac death, and fibrofatty replacement of cardiomyocytes. This gene contains a response element for PPAR gamma (an adipogenic transcription factor), which may explain the fibrofatty replacement of the myocardium, a characteristic pathological finding in ARVC. [provided by RefSeq, Oct 2008]
PHENOTYPE: In a gihg-throughput screen, female homozygous mutant mice exhibited an increased anxiety-like response during open field activity testing when compared with their gender-matched wild-type littermates and the historical mean. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 8,992,700 Y227F possibly damaging Het
4921501E09Rik T C 17: 33,065,257 D857G probably benign Het
Aadac T C 3: 60,036,075 probably benign Het
Abl2 G A 1: 156,642,232 G918E possibly damaging Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Adck1 T C 12: 88,455,603 V328A probably benign Het
Ano6 A G 15: 95,916,037 I279V probably benign Het
AW551984 T A 9: 39,590,698 Y704F probably benign Het
C1s1 T C 6: 124,534,401 D321G probably damaging Het
Cacna1d T A 14: 30,045,279 D1910V possibly damaging Het
Ccdc129 T A 6: 55,978,290 L961H probably benign Het
Cdh5 A G 8: 104,137,847 Q480R probably benign Het
Cdhr1 C T 14: 37,089,007 V266M possibly damaging Het
Cdk5rap1 A T 2: 154,350,835 V414D possibly damaging Het
Ctdnep1 T A 11: 69,984,396 probably benign Het
Cyfip2 T C 11: 46,278,091 M212V possibly damaging Het
D130043K22Rik G A 13: 24,857,414 S273N probably benign Het
Ddi2 A G 4: 141,684,852 S250P probably damaging Het
Dennd1b A G 1: 139,167,671 T486A probably benign Het
Disc1 A G 8: 125,135,457 T523A probably damaging Het
Dmbx1 A G 4: 115,918,145 S313P probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnah11 T C 12: 118,085,697 E1664G probably damaging Het
Dpysl3 A T 18: 43,438,038 V57E probably damaging Het
Fam98a C T 17: 75,538,581 G390E unknown Het
Hook3 C A 8: 26,118,989 R9L probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Impg2 A G 16: 56,243,626 D298G probably benign Het
Inf2 T A 12: 112,600,145 V48D probably damaging Het
Kcnh1 G A 1: 192,505,691 G820D probably benign Het
Lsm14a C T 7: 34,389,364 A39T possibly damaging Het
Muc2 T C 7: 141,753,719 C804R probably damaging Het
Nim1k C T 13: 119,727,799 V25M probably benign Het
Olfr1246 T C 2: 89,591,113 M1V probably null Het
Olfr1484 T A 19: 13,586,075 M257K probably damaging Het
Olfr741 T A 14: 50,486,052 L198* probably null Het
Olfr780 A G 10: 129,322,336 T238A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pitrm1 T A 13: 6,577,432 H856Q probably damaging Het
Pkd1 T C 17: 24,574,375 C1679R probably benign Het
Pkp4 T A 2: 59,310,273 L441* probably null Het
Ppp4r4 T C 12: 103,584,168 F284L probably benign Het
Ptprt T A 2: 161,698,049 K769M probably damaging Het
Rbm12 G T 2: 156,103,365 probably benign Het
Rpf1 T C 3: 146,519,391 D94G possibly damaging Het
Scap G T 9: 110,374,529 K310N probably damaging Het
Smpd2 C T 10: 41,488,702 probably benign Het
Sp110 TC TCC 1: 85,591,569 probably null Het
Specc1l T A 10: 75,246,705 I662N possibly damaging Het
Sptan1 T A 2: 30,011,328 V1496D probably damaging Het
Srrm4 T C 5: 116,471,260 probably benign Het
Taf2 A G 15: 55,049,419 I515T possibly damaging Het
Tdrd3 C T 14: 87,480,791 Q203* probably null Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Trav9-1 T A 14: 53,488,376 I49N probably benign Het
Trim23 T G 13: 104,198,697 N410K probably damaging Het
Ttbk1 T C 17: 46,467,416 T567A probably damaging Het
Unc79 A G 12: 103,104,627 N1081S possibly damaging Het
Zfp451 A C 1: 33,813,806 I9R probably damaging Het
Zfp563 T A 17: 33,104,707 M92K probably benign Het
Zfp618 G A 4: 63,095,492 G198D probably benign Het
Zfp637 G T 6: 117,843,309 probably benign Het
Other mutations in Tmem43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Tmem43 APN 6 91477374 missense possibly damaging 0.73
IGL03105:Tmem43 APN 6 91480700 missense probably damaging 1.00
R0415:Tmem43 UTSW 6 91482318 missense probably benign 0.13
R1388:Tmem43 UTSW 6 91478803 splice site probably null
R1581:Tmem43 UTSW 6 91478735 missense probably benign 0.01
R1777:Tmem43 UTSW 6 91477330 nonsense probably null
R1895:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R1946:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R2697:Tmem43 UTSW 6 91479929 missense possibly damaging 0.85
R4778:Tmem43 UTSW 6 91482255 missense probably damaging 1.00
R5205:Tmem43 UTSW 6 91486781 missense possibly damaging 0.89
R5366:Tmem43 UTSW 6 91478258 missense probably benign 0.43
R5516:Tmem43 UTSW 6 91478210 missense possibly damaging 0.70
R5569:Tmem43 UTSW 6 91477354 missense probably benign 0.01
R5656:Tmem43 UTSW 6 91480708 missense probably benign 0.01
R6490:Tmem43 UTSW 6 91478777 missense probably damaging 0.97
R6490:Tmem43 UTSW 6 91486880 missense possibly damaging 0.91
R7853:Tmem43 UTSW 6 91481986 missense probably benign 0.06
R7936:Tmem43 UTSW 6 91481986 missense probably benign 0.06
S24628:Tmem43 UTSW 6 91482318 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GTCAGACGTCGGACTACATTTC -3'
(R):5'- GACTAATTGCTGAGGCCCAC -3'

Sequencing Primer
(F):5'- GTCGGACTACATTTCCCAGCAG -3'
(R):5'- TTGCTGAGGCCCACAAACG -3'
Posted On2016-08-04