Incidental Mutation 'R5383:Dmpk'
ID424845
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission 042958-MU
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R5383 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 19088019 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 301 (L301V)
Ref Sequence ENSEMBL: ENSMUSP00000104114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
AA Change: L301V

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135839
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143938
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148380
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152050
Predicted Effect probably benign
Transcript: ENSMUST00000154199
AA Change: L301V

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: L301V

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174918
Meta Mutation Damage Score 0.0903 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 8,992,700 Y227F possibly damaging Het
4921501E09Rik T C 17: 33,065,257 D857G probably benign Het
Aadac T C 3: 60,036,075 probably benign Het
Abl2 G A 1: 156,642,232 G918E possibly damaging Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Adck1 T C 12: 88,455,603 V328A probably benign Het
Ano6 A G 15: 95,916,037 I279V probably benign Het
AW551984 T A 9: 39,590,698 Y704F probably benign Het
C1s1 T C 6: 124,534,401 D321G probably damaging Het
Cacna1d T A 14: 30,045,279 D1910V possibly damaging Het
Ccdc129 T A 6: 55,978,290 L961H probably benign Het
Cdh5 A G 8: 104,137,847 Q480R probably benign Het
Cdhr1 C T 14: 37,089,007 V266M possibly damaging Het
Cdk5rap1 A T 2: 154,350,835 V414D possibly damaging Het
Ctdnep1 T A 11: 69,984,396 probably benign Het
Cyfip2 T C 11: 46,278,091 M212V possibly damaging Het
D130043K22Rik G A 13: 24,857,414 S273N probably benign Het
Ddi2 A G 4: 141,684,852 S250P probably damaging Het
Dennd1b A G 1: 139,167,671 T486A probably benign Het
Disc1 A G 8: 125,135,457 T523A probably damaging Het
Dmbx1 A G 4: 115,918,145 S313P probably damaging Het
Dnah11 T C 12: 118,085,697 E1664G probably damaging Het
Dpysl3 A T 18: 43,438,038 V57E probably damaging Het
Fam98a C T 17: 75,538,581 G390E unknown Het
Hook3 C A 8: 26,118,989 R9L probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Impg2 A G 16: 56,243,626 D298G probably benign Het
Inf2 T A 12: 112,600,145 V48D probably damaging Het
Kcnh1 G A 1: 192,505,691 G820D probably benign Het
Lsm14a C T 7: 34,389,364 A39T possibly damaging Het
Muc2 T C 7: 141,753,719 C804R probably damaging Het
Nim1k C T 13: 119,727,799 V25M probably benign Het
Olfr1246 T C 2: 89,591,113 M1V probably null Het
Olfr1484 T A 19: 13,586,075 M257K probably damaging Het
Olfr741 T A 14: 50,486,052 L198* probably null Het
Olfr780 A G 10: 129,322,336 T238A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pitrm1 T A 13: 6,577,432 H856Q probably damaging Het
Pkd1 T C 17: 24,574,375 C1679R probably benign Het
Pkp4 T A 2: 59,310,273 L441* probably null Het
Ppp4r4 T C 12: 103,584,168 F284L probably benign Het
Ptprt T A 2: 161,698,049 K769M probably damaging Het
Rbm12 G T 2: 156,103,365 probably benign Het
Rpf1 T C 3: 146,519,391 D94G possibly damaging Het
Scap G T 9: 110,374,529 K310N probably damaging Het
Smpd2 C T 10: 41,488,702 probably benign Het
Sp110 TC TCC 1: 85,591,569 probably null Het
Specc1l T A 10: 75,246,705 I662N possibly damaging Het
Sptan1 T A 2: 30,011,328 V1496D probably damaging Het
Srrm4 T C 5: 116,471,260 probably benign Het
Taf2 A G 15: 55,049,419 I515T possibly damaging Het
Tdrd3 C T 14: 87,480,791 Q203* probably null Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Tmem43 G A 6: 91,473,890 A2T probably benign Het
Trav9-1 T A 14: 53,488,376 I49N probably benign Het
Trim23 T G 13: 104,198,697 N410K probably damaging Het
Ttbk1 T C 17: 46,467,416 T567A probably damaging Het
Unc79 A G 12: 103,104,627 N1081S possibly damaging Het
Zfp451 A C 1: 33,813,806 I9R probably damaging Het
Zfp563 T A 17: 33,104,707 M92K probably benign Het
Zfp618 G A 4: 63,095,492 G198D probably benign Het
Zfp637 G T 6: 117,843,309 probably benign Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- ACTTAGTGGCTTGTGCTCC -3'
(R):5'- CTCGAAGTCTGGTGTAAAGGGG -3'

Sequencing Primer
(F):5'- TAGTGGCTTGTGCTCCCAGAC -3'
(R):5'- GGGTACACTGTCTCGGAGACC -3'
Posted On2016-08-04