Incidental Mutation 'R5383:Ppp4r4'
ID424861
Institutional Source Beutler Lab
Gene Symbol Ppp4r4
Ensembl Gene ENSMUSG00000021209
Gene Nameprotein phosphatase 4, regulatory subunit 4
Synonyms8430415E04Rik
MMRRC Submission 042958-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R5383 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103532283-103613831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103584168 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 284 (F284L)
Ref Sequence ENSEMBL: ENSMUSP00000139786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190664]
Predicted Effect probably benign
Transcript: ENSMUST00000021631
AA Change: F284L

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209
AA Change: F284L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 55 577 6e-27 SMART
PDB:3FGA|A 178 666 8e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187155
AA Change: F175L

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209
AA Change: F175L

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189871
AA Change: F284L

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209
AA Change: F284L

DomainStartEndE-ValueType
SCOP:d1gw5a_ 95 577 7e-26 SMART
PDB:1B3U|B 178 666 2e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190664
AA Change: F68L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000140295
Gene: ENSMUSG00000021209
AA Change: F68L

DomainStartEndE-ValueType
Pfam:HEAT 38 68 5.8e-4 PFAM
Meta Mutation Damage Score 0.1209 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 8,992,700 Y227F possibly damaging Het
4921501E09Rik T C 17: 33,065,257 D857G probably benign Het
Aadac T C 3: 60,036,075 probably benign Het
Abl2 G A 1: 156,642,232 G918E possibly damaging Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Adck1 T C 12: 88,455,603 V328A probably benign Het
Ano6 A G 15: 95,916,037 I279V probably benign Het
AW551984 T A 9: 39,590,698 Y704F probably benign Het
C1s1 T C 6: 124,534,401 D321G probably damaging Het
Cacna1d T A 14: 30,045,279 D1910V possibly damaging Het
Ccdc129 T A 6: 55,978,290 L961H probably benign Het
Cdh5 A G 8: 104,137,847 Q480R probably benign Het
Cdhr1 C T 14: 37,089,007 V266M possibly damaging Het
Cdk5rap1 A T 2: 154,350,835 V414D possibly damaging Het
Ctdnep1 T A 11: 69,984,396 probably benign Het
Cyfip2 T C 11: 46,278,091 M212V possibly damaging Het
D130043K22Rik G A 13: 24,857,414 S273N probably benign Het
Ddi2 A G 4: 141,684,852 S250P probably damaging Het
Dennd1b A G 1: 139,167,671 T486A probably benign Het
Disc1 A G 8: 125,135,457 T523A probably damaging Het
Dmbx1 A G 4: 115,918,145 S313P probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnah11 T C 12: 118,085,697 E1664G probably damaging Het
Dpysl3 A T 18: 43,438,038 V57E probably damaging Het
Fam98a C T 17: 75,538,581 G390E unknown Het
Hook3 C A 8: 26,118,989 R9L probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Impg2 A G 16: 56,243,626 D298G probably benign Het
Inf2 T A 12: 112,600,145 V48D probably damaging Het
Kcnh1 G A 1: 192,505,691 G820D probably benign Het
Lsm14a C T 7: 34,389,364 A39T possibly damaging Het
Muc2 T C 7: 141,753,719 C804R probably damaging Het
Nim1k C T 13: 119,727,799 V25M probably benign Het
Olfr1246 T C 2: 89,591,113 M1V probably null Het
Olfr1484 T A 19: 13,586,075 M257K probably damaging Het
Olfr741 T A 14: 50,486,052 L198* probably null Het
Olfr780 A G 10: 129,322,336 T238A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pitrm1 T A 13: 6,577,432 H856Q probably damaging Het
Pkd1 T C 17: 24,574,375 C1679R probably benign Het
Pkp4 T A 2: 59,310,273 L441* probably null Het
Ptprt T A 2: 161,698,049 K769M probably damaging Het
Rbm12 G T 2: 156,103,365 probably benign Het
Rpf1 T C 3: 146,519,391 D94G possibly damaging Het
Scap G T 9: 110,374,529 K310N probably damaging Het
Smpd2 C T 10: 41,488,702 probably benign Het
Sp110 TC TCC 1: 85,591,569 probably null Het
Specc1l T A 10: 75,246,705 I662N possibly damaging Het
Sptan1 T A 2: 30,011,328 V1496D probably damaging Het
Srrm4 T C 5: 116,471,260 probably benign Het
Taf2 A G 15: 55,049,419 I515T possibly damaging Het
Tdrd3 C T 14: 87,480,791 Q203* probably null Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Tmem43 G A 6: 91,473,890 A2T probably benign Het
Trav9-1 T A 14: 53,488,376 I49N probably benign Het
Trim23 T G 13: 104,198,697 N410K probably damaging Het
Ttbk1 T C 17: 46,467,416 T567A probably damaging Het
Unc79 A G 12: 103,104,627 N1081S possibly damaging Het
Zfp451 A C 1: 33,813,806 I9R probably damaging Het
Zfp563 T A 17: 33,104,707 M92K probably benign Het
Zfp618 G A 4: 63,095,492 G198D probably benign Het
Zfp637 G T 6: 117,843,309 probably benign Het
Other mutations in Ppp4r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Ppp4r4 APN 12 103579076 missense probably benign
IGL01388:Ppp4r4 APN 12 103576849 missense probably damaging 1.00
IGL01662:Ppp4r4 APN 12 103602966 missense possibly damaging 0.55
IGL01768:Ppp4r4 APN 12 103581405 missense probably benign 0.12
IGL01894:Ppp4r4 APN 12 103593138 missense probably damaging 1.00
IGL01921:Ppp4r4 APN 12 103576310 start codon destroyed probably null 0.01
IGL01960:Ppp4r4 APN 12 103581494 splice site probably benign
IGL02084:Ppp4r4 APN 12 103600398 missense possibly damaging 0.93
IGL02287:Ppp4r4 APN 12 103587488 missense probably benign 0.01
IGL02315:Ppp4r4 APN 12 103600361 splice site probably benign
IGL03137:Ppp4r4 APN 12 103581384 missense probably damaging 1.00
IGL03170:Ppp4r4 APN 12 103590774 intron probably benign
cataract UTSW 12 103612815 nonsense probably null
downfall UTSW 12 103593098 missense probably benign 0.00
R0114:Ppp4r4 UTSW 12 103576374 missense probably benign 0.00
R0390:Ppp4r4 UTSW 12 103601360 splice site probably benign
R0403:Ppp4r4 UTSW 12 103584102 missense probably benign
R0548:Ppp4r4 UTSW 12 103612815 nonsense probably null
R0601:Ppp4r4 UTSW 12 103600520 splice site probably benign
R0894:Ppp4r4 UTSW 12 103600495 missense probably damaging 0.99
R1127:Ppp4r4 UTSW 12 103579068 missense probably damaging 1.00
R1177:Ppp4r4 UTSW 12 103576323 missense possibly damaging 0.82
R1378:Ppp4r4 UTSW 12 103581492 splice site probably benign
R1442:Ppp4r4 UTSW 12 103598245 missense probably damaging 0.97
R1497:Ppp4r4 UTSW 12 103606945 missense probably benign 0.07
R1651:Ppp4r4 UTSW 12 103584072 missense probably benign 0.01
R1797:Ppp4r4 UTSW 12 103598151 missense possibly damaging 0.95
R1880:Ppp4r4 UTSW 12 103605035 missense possibly damaging 0.62
R2008:Ppp4r4 UTSW 12 103585757 missense probably damaging 1.00
R2038:Ppp4r4 UTSW 12 103576280 critical splice acceptor site probably null
R2404:Ppp4r4 UTSW 12 103581490 splice site probably null
R2696:Ppp4r4 UTSW 12 103581394 missense possibly damaging 0.77
R2849:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R2965:Ppp4r4 UTSW 12 103612821 missense probably damaging 1.00
R3030:Ppp4r4 UTSW 12 103606956 missense probably benign
R3805:Ppp4r4 UTSW 12 103600366 missense probably damaging 0.99
R3862:Ppp4r4 UTSW 12 103596421 nonsense probably null
R4194:Ppp4r4 UTSW 12 103558445 missense probably damaging 1.00
R4320:Ppp4r4 UTSW 12 103598243 missense probably damaging 1.00
R4558:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R4783:Ppp4r4 UTSW 12 103590858 critical splice donor site probably null
R4866:Ppp4r4 UTSW 12 103600447 missense possibly damaging 0.92
R4903:Ppp4r4 UTSW 12 103590771 splice site probably null
R5309:Ppp4r4 UTSW 12 103606888 splice site probably null
R5312:Ppp4r4 UTSW 12 103606888 splice site probably null
R5381:Ppp4r4 UTSW 12 103593098 missense probably benign 0.00
R5447:Ppp4r4 UTSW 12 103584151 missense possibly damaging 0.67
R5942:Ppp4r4 UTSW 12 103587447 missense possibly damaging 0.92
R6339:Ppp4r4 UTSW 12 103604969 nonsense probably null
R6386:Ppp4r4 UTSW 12 103593105 missense probably damaging 1.00
R6712:Ppp4r4 UTSW 12 103596443 missense probably damaging 1.00
R6755:Ppp4r4 UTSW 12 103585737 missense probably damaging 1.00
R6868:Ppp4r4 UTSW 12 103590852 missense probably damaging 1.00
R6879:Ppp4r4 UTSW 12 103551920 intron probably null
R7355:Ppp4r4 UTSW 12 103604582 nonsense probably null
R7397:Ppp4r4 UTSW 12 103612806 critical splice acceptor site probably null
R7447:Ppp4r4 UTSW 12 103585726 missense possibly damaging 0.46
R7576:Ppp4r4 UTSW 12 103596449 missense probably damaging 0.97
R7653:Ppp4r4 UTSW 12 103584145 missense probably damaging 0.98
R7683:Ppp4r4 UTSW 12 103587105 nonsense probably null
X0025:Ppp4r4 UTSW 12 103600480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAGTTGATTTATTAGAGTCTGGC -3'
(R):5'- TGCCAGTCATGTTCTGATGAG -3'

Sequencing Primer
(F):5'- AGAGTCTGGCTGCAGGTTGC -3'
(R):5'- CCAGTCATGTTCTGATGAGAGAAATG -3'
Posted On2016-08-04