Incidental Mutation 'R0491:Hic1'
ID42487
Institutional Source Beutler Lab
Gene Symbol Hic1
Ensembl Gene ENSMUSG00000043099
Gene Namehypermethylated in cancer 1
SynonymsHIC-1
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.390) question?
Stock #R0491 (G1)
Quality Score217
Status Validated
Chromosome11
Chromosomal Location75164565-75169519 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75166310 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 584 (L584F)
Ref Sequence ENSEMBL: ENSMUSP00000053483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]
Predicted Effect probably benign
Transcript: ENSMUST00000045281
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000055619
AA Change: L584F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099
AA Change: L584F

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
BTB 207 313 6.94e-24 SMART
low complexity region 318 340 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
Blast:BTB 375 398 1e-7 BLAST
low complexity region 415 437 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
ZnF_C2H2 597 619 1.08e-1 SMART
ZnF_C2H2 667 689 1.18e-2 SMART
ZnF_C2H2 695 717 9.36e-6 SMART
ZnF_C2H2 723 745 4.54e-4 SMART
ZnF_C2H2 751 773 5.21e-4 SMART
low complexity region 774 804 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153226
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit varying abnormalities, such as acrania, exencephaly, cleft palate, limb defects, and omphalocele, and die perinatally. Heterozygotes develop tumors, including lymphomas, sarcomas, and epithelial cancers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Hic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Hic1 APN 11 75165519 missense possibly damaging 0.96
R0138:Hic1 UTSW 11 75167343 missense probably damaging 0.99
R0331:Hic1 UTSW 11 75165490 missense possibly damaging 0.53
R0521:Hic1 UTSW 11 75166887 missense possibly damaging 0.68
R0744:Hic1 UTSW 11 75165801 missense possibly damaging 0.52
R1766:Hic1 UTSW 11 75165794 nonsense probably null
R2070:Hic1 UTSW 11 75169059 missense possibly damaging 0.68
R2211:Hic1 UTSW 11 75169384 missense possibly damaging 0.59
R5418:Hic1 UTSW 11 75166599 unclassified probably null
R6047:Hic1 UTSW 11 75166849 missense possibly damaging 0.94
R6076:Hic1 UTSW 11 75167328 missense probably damaging 1.00
R6415:Hic1 UTSW 11 75166317 missense possibly damaging 0.93
R6633:Hic1 UTSW 11 75169498 missense unknown
R7122:Hic1 UTSW 11 75169230 missense probably benign
R7308:Hic1 UTSW 11 75167151 missense probably damaging 1.00
R7761:Hic1 UTSW 11 75167374 missense probably damaging 0.97
R7778:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
R7824:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
RF029:Hic1 UTSW 11 75169442 small deletion probably benign
RF043:Hic1 UTSW 11 75169455 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GCGTGAACTTCTTTCCGCAGATG -3'
(R):5'- GGTAGTTATGGCGATGAACTGGTCC -3'

Sequencing Primer
(F):5'- TTTCCGCAGATGGTACACG -3'
(R):5'- AACTGGTCCGGGATCGAG -3'
Posted On2013-05-23