Mutagenetix > Incidental Mutations

Incidental Mutation 'R0491:Plekhm1'

42488

Institutional Source

Beutler Lab

Gene Symbol

Plekhm1

Ensembl Gene

ENSMUSG00000034247

Gene Name

pleckstrin homology domain containing, family M (with RUN domain) member 1

Synonyms

B2, D330036J23Rik, AP162

MMRRC Submission

038689-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0491 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

103364275-103412687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 103394776 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 278 (K278E)

Ref Sequence

ENSEMBL: ENSMUSP00000047327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041272]

Predicted Effect

probably benign
Transcript: ENSMUST00000041272
AA Change: K278E

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: K278E

Domain	Start	End	E-Value	Type
RUN	117	180	3.36e-20	SMART
low complexity region	246	273	N/A	INTRINSIC
low complexity region	336	350	N/A	INTRINSIC
low complexity region	361	373	N/A	INTRINSIC
Blast:DUF4206	448	543	2e-11	BLAST
PH	552	644	2.16e-9	SMART
low complexity region	658	674	N/A	INTRINSIC
PH	702	797	2.15e-4	SMART
DUF4206	864	1068	7.51e-103	SMART
C1	1005	1058	2.72e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184350

Meta Mutation Damage Score

0.0619

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.4%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,182,243	S356T	probably damaging	Het
Abca13	T	C	11: 9,298,235	F2661L	probably benign	Het
Acadsb	A	G	7: 131,430,107	D224G	probably benign	Het
Acsm1	A	G	7: 119,640,697	H288R	probably damaging	Het
Adamts2	A	G	11: 50,776,630	D465G	probably damaging	Het
Akap9	A	T	5: 3,972,851		probably benign	Het
Alms1	A	G	6: 85,702,600	T3240A	probably damaging	Het
Ap3d1	A	G	10: 80,719,241	W417R	probably damaging	Het
Arfgef1	C	A	1: 10,179,987		probably benign	Het
Atf6	A	G	1: 170,787,344		probably null	Het
Cacna1s	T	A	1: 136,089,008		probably benign	Het
Clcn1	T	C	6: 42,310,581	F740L	probably benign	Het
Clec12a	T	A	6: 129,364,053	D265E	probably benign	Het
Clic3	T	A	2: 25,457,785		probably benign	Het
Cntnap3	T	G	13: 64,762,045	T749P	probably benign	Het
Col11a2	T	A	17: 34,042,212	D45E	probably null	Het
Crxos	T	A	7: 15,898,535	S89T	probably benign	Het
Cxcr1	G	T	1: 74,192,309	P185T	possibly damaging	Het
Cyp20a1	T	A	1: 60,371,327	N262K	possibly damaging	Het
Dpy19l2	T	C	9: 24,696,028	R46G	probably benign	Het
Dpysl2	A	T	14: 66,807,962	L454Q	probably damaging	Het
Dvl3	C	T	16: 20,527,423		probably benign	Het
Eppin	T	A	2: 164,589,412	E98V	possibly damaging	Het
Fancm	A	T	12: 65,106,061	H1097L	probably benign	Het
Fkbp4	A	G	6: 128,435,742	I75T	probably damaging	Het
Fmn2	A	G	1: 174,581,959	H586R	unknown	Het
Gm973	C	T	1: 59,558,234		probably benign	Het
Haus6	A	C	4: 86,602,846	V185G	possibly damaging	Het
Herc2	T	A	7: 56,122,366	C1098S	possibly damaging	Het
Hic1	C	A	11: 75,166,310	L584F	possibly damaging	Het
Itgb1bp1	C	A	12: 21,276,895		probably benign	Het
Kbtbd2	G	A	6: 56,780,389	R121*	probably null	Het
Lgr4	C	T	2: 110,007,281		probably benign	Het
Lrrc55	T	C	2: 85,191,920	E309G	probably damaging	Het
Mertk	T	C	2: 128,793,107		probably null	Het
Micu3	A	G	8: 40,366,253		probably benign	Het
Mmp11	G	A	10: 75,926,758	A287V	probably benign	Het
Mpzl2	A	G	9: 45,042,741	Y47C	probably damaging	Het
Muc5b	A	C	7: 141,862,015	R2899S	probably benign	Het
Myo1b	A	G	1: 51,755,698	Y1078H	probably benign	Het
Naip1	A	T	13: 100,423,219	D1092E	probably benign	Het
Ncapd3	T	G	9: 27,057,883	V611G	probably damaging	Het
Ntpcr	C	T	8: 125,737,354	R73*	probably null	Het
Olfr1225	A	T	2: 89,170,360	V284E	probably benign	Het
Olfr1475	G	A	19: 13,479,493	A235V	probably damaging	Het
Osbp2	A	G	11: 3,714,709	F88S	probably damaging	Het
Pkn3	A	T	2: 30,089,877	T711S	probably damaging	Het
Ppp1r36	A	G	12: 76,439,291	T408A	probably benign	Het
Prss41	T	C	17: 23,842,503	T105A	possibly damaging	Het
Psme1	G	T	14: 55,579,921		probably benign	Het
Ptprq	A	T	10: 107,608,175	Y1523N	probably damaging	Het
Ric8b	A	G	10: 84,992,222	D470G	probably damaging	Het
Scarb1	A	G	5: 125,298,731		probably benign	Het
Slc25a54	G	A	3: 109,102,796	A204T	probably damaging	Het
Spink10	T	C	18: 62,659,965	C67R	probably damaging	Het
St5	T	A	7: 109,557,204	Q113L	probably benign	Het
Tmtc1	A	T	6: 148,412,640		probably null	Het
Tprkb	A	G	6: 85,924,464	D28G	probably benign	Het
Ttll13	A	G	7: 80,260,350	H747R	probably benign	Het
Usp24	A	G	4: 106,402,105	S1608G	probably benign	Het
Utp20	A	T	10: 88,760,912	F2115L	probably damaging	Het
Vmn1r200	A	T	13: 22,395,191	I46L	probably benign	Het
Zdhhc8	A	T	16: 18,228,390	M103K	probably damaging	Het
Zfp595	C	T	13: 67,317,305	G298E	probably damaging	Het
Zfp738	T	G	13: 67,670,021	H617P	possibly damaging	Het
Zfp9	A	T	6: 118,465,202	H166Q	probably damaging	Het
Zp3r	C	A	1: 130,618,334	D80Y	probably damaging	Het

Other mutations in Plekhm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01517:Plekhm1	APN	11	103394783	missense	possibly damaging	0.54
IGL01876:Plekhm1	APN	11	103376751	missense	probably damaging	1.00
IGL02159:Plekhm1	APN	11	103380231	missense	probably benign	0.04
IGL02404:Plekhm1	APN	11	103394998	missense	probably benign	0.18
IGL02537:Plekhm1	APN	11	103397192	missense	probably damaging	1.00
IGL02568:Plekhm1	APN	11	103395050	missense	probably damaging	1.00
IGL02660:Plekhm1	APN	11	103374094	splice site	probably benign
IGL03130:Plekhm1	APN	11	103377381	missense	probably benign	0.17
IGL03208:Plekhm1	APN	11	103376770	missense	probably benign	0.00
R0442:Plekhm1	UTSW	11	103397174	missense	possibly damaging	0.45
R0520:Plekhm1	UTSW	11	103394944	missense	probably benign	0.17
R0964:Plekhm1	UTSW	11	103395082	nonsense	probably null
R1189:Plekhm1	UTSW	11	103387062	missense	probably benign	0.00
R1501:Plekhm1	UTSW	11	103387062	missense	probably benign	0.00
R1697:Plekhm1	UTSW	11	103376884	missense	probably damaging	1.00
R1781:Plekhm1	UTSW	11	103394856	missense	probably damaging	1.00
R1873:Plekhm1	UTSW	11	103373998	missense	probably benign	0.01
R2087:Plekhm1	UTSW	11	103397025	critical splice donor site	probably null
R2215:Plekhm1	UTSW	11	103376985	missense	probably damaging	1.00
R2271:Plekhm1	UTSW	11	103387122	missense	probably benign	0.00
R4256:Plekhm1	UTSW	11	103370934	missense	probably damaging	0.98
R4393:Plekhm1	UTSW	11	103376965	missense	possibly damaging	0.51
R4526:Plekhm1	UTSW	11	103395304	missense	probably damaging	0.97
R5119:Plekhm1	UTSW	11	103387315	missense	possibly damaging	0.62
R5975:Plekhm1	UTSW	11	103376691	missense	possibly damaging	0.49
R6389:Plekhm1	UTSW	11	103366894	missense	probably benign	0.21
R6454:Plekhm1	UTSW	11	103377382	missense	probably damaging	1.00
R6755:Plekhm1	UTSW	11	103387243	missense	possibly damaging	0.65
R6830:Plekhm1	UTSW	11	103376889	missense	probably damaging	0.97
R7039:Plekhm1	UTSW	11	103395228	missense	probably damaging	1.00
R7066:Plekhm1	UTSW	11	103370988	missense	possibly damaging	0.47
R7149:Plekhm1	UTSW	11	103394916	missense	probably damaging	0.98
R7349:Plekhm1	UTSW	11	103387334	missense	probably damaging	0.98
R7505:Plekhm1	UTSW	11	103380029	splice site	probably null
R7792:Plekhm1	UTSW	11	103397060	missense	probably damaging	0.99
R7867:Plekhm1	UTSW	11	103380327	missense	probably damaging	1.00
R7950:Plekhm1	UTSW	11	103380327	missense	probably damaging	1.00
X0058:Plekhm1	UTSW	11	103377366	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGGCCAAAGTCTCGGTTCAACTC -3'
(R):5'- AGGACATCGAAGTCCAACACTCAGG -3'

Sequencing Primer
(F):5'- ggaaacgagatgagtcccag -3'
(R):5'- TCAGGCCATAAGATCCGCAG -3'

Posted On

2013-05-23