Incidental Mutation 'R5383:Fam98a'
ID424881
Institutional Source Beutler Lab
Gene Symbol Fam98a
Ensembl Gene ENSMUSG00000002017
Gene Namefamily with sequence similarity 98, member A
Synonyms2810405J04Rik
MMRRC Submission 042958-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R5383 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location75537086-75551946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75538581 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 390 (G390E)
Ref Sequence ENSEMBL: ENSMUSP00000108126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112507]
Predicted Effect unknown
Transcript: ENSMUST00000112507
AA Change: G390E
SMART Domains Protein: ENSMUSP00000108126
Gene: ENSMUSG00000002017
AA Change: G390E

DomainStartEndE-ValueType
Pfam:DUF2465 11 328 1.1e-137 PFAM
low complexity region 334 396 N/A INTRINSIC
low complexity region 401 441 N/A INTRINSIC
low complexity region 448 481 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140729
Meta Mutation Damage Score 0.0693 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 8,992,700 Y227F possibly damaging Het
4921501E09Rik T C 17: 33,065,257 D857G probably benign Het
Aadac T C 3: 60,036,075 probably benign Het
Abl2 G A 1: 156,642,232 G918E possibly damaging Het
Acvr1c T C 2: 58,287,735 T241A probably damaging Het
Adck1 T C 12: 88,455,603 V328A probably benign Het
Ano6 A G 15: 95,916,037 I279V probably benign Het
AW551984 T A 9: 39,590,698 Y704F probably benign Het
C1s1 T C 6: 124,534,401 D321G probably damaging Het
Cacna1d T A 14: 30,045,279 D1910V possibly damaging Het
Ccdc129 T A 6: 55,978,290 L961H probably benign Het
Cdh5 A G 8: 104,137,847 Q480R probably benign Het
Cdhr1 C T 14: 37,089,007 V266M possibly damaging Het
Cdk5rap1 A T 2: 154,350,835 V414D possibly damaging Het
Ctdnep1 T A 11: 69,984,396 probably benign Het
Cyfip2 T C 11: 46,278,091 M212V possibly damaging Het
D130043K22Rik G A 13: 24,857,414 S273N probably benign Het
Ddi2 A G 4: 141,684,852 S250P probably damaging Het
Dennd1b A G 1: 139,167,671 T486A probably benign Het
Disc1 A G 8: 125,135,457 T523A probably damaging Het
Dmbx1 A G 4: 115,918,145 S313P probably damaging Het
Dmpk C G 7: 19,088,019 L301V probably benign Het
Dnah11 T C 12: 118,085,697 E1664G probably damaging Het
Dpysl3 A T 18: 43,438,038 V57E probably damaging Het
Hook3 C A 8: 26,118,989 R9L probably benign Het
Igkv4-80 A C 6: 69,016,665 S81A probably benign Het
Impg2 A G 16: 56,243,626 D298G probably benign Het
Inf2 T A 12: 112,600,145 V48D probably damaging Het
Kcnh1 G A 1: 192,505,691 G820D probably benign Het
Lsm14a C T 7: 34,389,364 A39T possibly damaging Het
Muc2 T C 7: 141,753,719 C804R probably damaging Het
Nim1k C T 13: 119,727,799 V25M probably benign Het
Olfr1246 T C 2: 89,591,113 M1V probably null Het
Olfr1484 T A 19: 13,586,075 M257K probably damaging Het
Olfr741 T A 14: 50,486,052 L198* probably null Het
Olfr780 A G 10: 129,322,336 T238A probably damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pitrm1 T A 13: 6,577,432 H856Q probably damaging Het
Pkd1 T C 17: 24,574,375 C1679R probably benign Het
Pkp4 T A 2: 59,310,273 L441* probably null Het
Ppp4r4 T C 12: 103,584,168 F284L probably benign Het
Ptprt T A 2: 161,698,049 K769M probably damaging Het
Rbm12 G T 2: 156,103,365 probably benign Het
Rpf1 T C 3: 146,519,391 D94G possibly damaging Het
Scap G T 9: 110,374,529 K310N probably damaging Het
Smpd2 C T 10: 41,488,702 probably benign Het
Sp110 TC TCC 1: 85,591,569 probably null Het
Specc1l T A 10: 75,246,705 I662N possibly damaging Het
Sptan1 T A 2: 30,011,328 V1496D probably damaging Het
Srrm4 T C 5: 116,471,260 probably benign Het
Taf2 A G 15: 55,049,419 I515T possibly damaging Het
Tdrd3 C T 14: 87,480,791 Q203* probably null Het
Tfap2b A T 1: 19,226,498 M222L probably benign Het
Tmem43 G A 6: 91,473,890 A2T probably benign Het
Trav9-1 T A 14: 53,488,376 I49N probably benign Het
Trim23 T G 13: 104,198,697 N410K probably damaging Het
Ttbk1 T C 17: 46,467,416 T567A probably damaging Het
Unc79 A G 12: 103,104,627 N1081S possibly damaging Het
Zfp451 A C 1: 33,813,806 I9R probably damaging Het
Zfp563 T A 17: 33,104,707 M92K probably benign Het
Zfp618 G A 4: 63,095,492 G198D probably benign Het
Zfp637 G T 6: 117,843,309 probably benign Het
Other mutations in Fam98a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Fam98a APN 17 75551747 missense probably damaging 1.00
IGL00548:Fam98a APN 17 75538818 missense probably damaging 1.00
IGL02170:Fam98a APN 17 75540192 critical splice acceptor site probably null
IGL02399:Fam98a APN 17 75538941 splice site probably benign
IGL03062:Fam98a APN 17 75540105 splice site probably benign
IGL03246:Fam98a APN 17 75538853 missense probably damaging 0.99
R0584:Fam98a UTSW 17 75544777 missense probably damaging 1.00
R0594:Fam98a UTSW 17 75538487 nonsense probably null
R1121:Fam98a UTSW 17 75538534 missense unknown
R1366:Fam98a UTSW 17 75539386 splice site probably benign
R1387:Fam98a UTSW 17 75538269 missense unknown
R1424:Fam98a UTSW 17 75540178 missense probably damaging 1.00
R1533:Fam98a UTSW 17 75541281 missense probably damaging 1.00
R1651:Fam98a UTSW 17 75547715 missense probably benign 0.16
R2211:Fam98a UTSW 17 75538945 critical splice donor site probably null
R4295:Fam98a UTSW 17 75541347 missense probably damaging 1.00
R4350:Fam98a UTSW 17 75541225 missense probably damaging 1.00
R4963:Fam98a UTSW 17 75538982 missense probably damaging 0.99
R5320:Fam98a UTSW 17 75538815 missense probably damaging 1.00
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R7058:Fam98a UTSW 17 75538389 missense unknown
R7182:Fam98a UTSW 17 75539018 nonsense probably null
R7505:Fam98a UTSW 17 75538238 missense unknown
R7554:Fam98a UTSW 17 75547675 nonsense probably null
R7566:Fam98a UTSW 17 75547662 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGCTGTTCAAACTGGCCC -3'
(R):5'- GGCGGCAGACCTAATGAAATTG -3'

Sequencing Primer
(F):5'- ACTGGCCCCCTTGATGATAAG -3'
(R):5'- GGCAGACCTAATGAAATTGAACCTC -3'
Posted On2016-08-04