Incidental Mutation 'R5384:Fat4'
ID424900
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene NameFAT atypical cadherin 4
Synonyms6030410K14Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5384 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location38886940-39011985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38995946 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3986 (S3986P)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000061260
AA Change: S3986P

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: S3986P

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,960 V246A probably benign Het
Abcc10 T C 17: 46,304,435 S1343G possibly damaging Het
Abcd3 C A 3: 121,761,410 probably null Het
Actl6a T A 3: 32,720,493 M335K probably damaging Het
Adamts9 A C 6: 92,798,018 C1090W probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Apeh A T 9: 108,086,463 L551H probably damaging Het
Avpr1a T A 10: 122,449,369 F189I probably damaging Het
BC034090 T A 1: 155,242,027 H115L possibly damaging Het
C4b A T 17: 34,737,661 D654E possibly damaging Het
Carns1 T A 19: 4,171,901 probably null Het
Ccdc146 T A 5: 21,308,713 E469V probably benign Het
Cdc27 A G 11: 104,507,140 I804T probably benign Het
Cdh23 G A 10: 60,337,762 T1651I probably damaging Het
Cenpo G A 12: 4,216,646 P154L probably damaging Het
Cenpu G A 8: 46,562,499 G150R probably benign Het
Chrna10 C A 7: 102,114,353 L78F probably damaging Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cidea A T 18: 67,360,166 D85V probably damaging Het
Cldn18 T C 9: 99,709,858 S31G possibly damaging Het
Clpb T A 7: 101,779,341 I436N probably damaging Het
Col11a2 T C 17: 34,059,174 probably null Het
Cul7 T C 17: 46,654,477 V527A probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dchs1 T A 7: 105,772,055 D386V probably damaging Het
Dcstamp A C 15: 39,759,319 Q345H probably damaging Het
Dlgap3 A G 4: 127,236,330 I955V probably damaging Het
Dvl1 A G 4: 155,853,686 D97G probably damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Efr3b G T 12: 3,983,419 F129L probably benign Het
Etaa1 G A 11: 17,947,539 L193F probably damaging Het
Fam13c G A 10: 70,553,069 S474N probably benign Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fastkd3 T C 13: 68,584,585 F342L probably benign Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fgr G A 4: 132,986,353 probably null Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gm20671 A G 5: 32,819,942 S1823P probably damaging Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gsdma A T 11: 98,666,449 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac9 A G 12: 34,429,558 Y223H probably damaging Het
Igsf5 C A 16: 96,391,026 T275N probably benign Het
Il23r G A 6: 67,486,291 H73Y probably benign Het
Ipo4 G T 14: 55,626,196 R1026S probably benign Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Khdrbs1 G T 4: 129,741,936 D75E possibly damaging Het
Lrwd1 A T 5: 136,123,874 D511E possibly damaging Het
Ly75 A T 2: 60,334,487 C782* probably null Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myof C T 19: 37,952,987 A792T probably damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Ncoa7 C A 10: 30,722,817 A37S probably benign Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Nr1d2 A T 14: 18,211,922 S394T probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1252 T A 2: 89,721,305 I269F possibly damaging Het
Olfr1508 T A 14: 52,463,257 T251S probably benign Het
Olfr165 A G 16: 19,407,797 L73P probably damaging Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Pate2 A G 9: 35,670,541 M44V probably damaging Het
Pikfyve T C 1: 65,244,409 L735S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld1 C A 3: 28,025,320 R90S probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppm1d A G 11: 85,311,783 E104G probably damaging Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Ppp1r42 A G 1: 9,999,435 L134P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss36 C A 7: 127,936,699 R288L probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Psma3 G T 12: 70,974,765 G7W probably damaging Het
Psmc3ip A T 11: 101,092,604 probably null Het
Qser1 T C 2: 104,786,642 E1275G probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rcc2 A T 4: 140,720,566 K468* probably null Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sec1 C A 7: 45,678,840 R261L probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Homo
Sgip1 G A 4: 102,934,566 V362I possibly damaging Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc12a9 A T 5: 137,331,014 L126Q probably damaging Het
Slx4 A G 16: 3,990,805 S424P probably damaging Het
Smg5 T C 3: 88,351,293 S524P probably damaging Het
Sncaip A G 18: 52,885,041 D418G probably damaging Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Spata31d1b C A 13: 59,718,218 T1060K possibly damaging Het
Spink6 A G 18: 44,082,280 T66A probably damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stk39 T A 2: 68,410,039 D116V probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Svep1 T C 4: 58,104,545 K1226R possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tas2r117 G T 6: 132,803,154 S85I probably benign Het
Tcf20 T A 15: 82,856,199 Q350H probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfb2m A C 1: 179,545,872 probably null Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Trappc8 A T 18: 20,833,062 probably null Het
Trbv30 A G 6: 41,281,920 T88A probably benign Het
Trim40 T A 17: 36,888,865 N107I probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Ttn A G 2: 76,878,348 probably benign Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn1r42 T A 6: 89,845,384 I68F probably damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa7 G T 17: 35,024,926 probably null Het
Xndc1 T C 7: 102,082,188 V378A probably benign Het
Zc3h12d A T 10: 7,853,250 D126V probably damaging Het
Zc3h13 A G 14: 75,343,619 N1682S probably benign Het
Zc3h15 T C 2: 83,660,230 I236T possibly damaging Het
Zfp13 A T 17: 23,581,182 I34N probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfyve28 A G 5: 34,216,967 C568R probably damaging Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38982249 missense probably damaging 1.00
IGL00509:Fat4 APN 3 38889039 missense probably damaging 1.00
IGL00698:Fat4 APN 3 38981145 missense probably benign 0.17
IGL00934:Fat4 APN 3 38890673 missense probably damaging 1.00
IGL01063:Fat4 APN 3 38890579 missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38957269 missense probably benign 0.00
IGL01313:Fat4 APN 3 39007201 missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38980658 missense probably damaging 1.00
IGL01328:Fat4 APN 3 38889991 missense probably damaging 1.00
IGL01374:Fat4 APN 3 38887498 missense probably damaging 1.00
IGL01412:Fat4 APN 3 38891181 missense probably benign 0.09
IGL01472:Fat4 APN 3 38888070 missense probably damaging 1.00
IGL01514:Fat4 APN 3 38949534 missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39009257 missense probably damaging 1.00
IGL01548:Fat4 APN 3 38887758 missense probably damaging 0.99
IGL01576:Fat4 APN 3 38888947 missense probably damaging 1.00
IGL01591:Fat4 APN 3 39010375 nonsense probably null
IGL01626:Fat4 APN 3 38951032 missense probably damaging 1.00
IGL01746:Fat4 APN 3 38991731 nonsense probably null
IGL01800:Fat4 APN 3 38981729 missense probably damaging 0.99
IGL01815:Fat4 APN 3 38888773 missense probably damaging 1.00
IGL01863:Fat4 APN 3 38970619 splice site probably benign
IGL01917:Fat4 APN 3 38889730 missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38979774 missense probably benign 0.10
IGL02060:Fat4 APN 3 39010271 missense probably damaging 1.00
IGL02103:Fat4 APN 3 38889199 missense probably damaging 0.97
IGL02119:Fat4 APN 3 38982939 missense probably benign 0.10
IGL02124:Fat4 APN 3 38888404 missense probably damaging 1.00
IGL02164:Fat4 APN 3 38996205 critical splice donor site probably null
IGL02182:Fat4 APN 3 38890546 missense probably damaging 1.00
IGL02207:Fat4 APN 3 38951263 missense probably benign 0.16
IGL02210:Fat4 APN 3 38891853 missense probably benign 0.01
IGL02257:Fat4 APN 3 39001139 missense probably benign 0.09
IGL02271:Fat4 APN 3 38979919 missense probably benign 0.18
IGL02305:Fat4 APN 3 39009988 missense probably damaging 1.00
IGL02314:Fat4 APN 3 38887630 missense probably damaging 1.00
IGL02455:Fat4 APN 3 38951131 missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38983046 missense probably benign
IGL02478:Fat4 APN 3 38888215 missense probably damaging 1.00
IGL02480:Fat4 APN 3 39010430 missense probably damaging 1.00
IGL02487:Fat4 APN 3 38887245 missense probably damaging 1.00
IGL02632:Fat4 APN 3 39002764 missense probably benign 0.04
IGL02665:Fat4 APN 3 39002836 missense probably benign 0.08
IGL02674:Fat4 APN 3 38983337 missense probably benign 0.35
IGL02692:Fat4 APN 3 38951086 missense probably damaging 1.00
IGL02710:Fat4 APN 3 38890595 missense probably damaging 1.00
IGL02803:Fat4 APN 3 38889295 missense probably damaging 1.00
IGL02834:Fat4 APN 3 38956744 missense probably damaging 1.00
IGL02891:Fat4 APN 3 38951273 missense probably damaging 1.00
IGL02982:Fat4 APN 3 38890843 missense probably damaging 1.00
IGL02993:Fat4 APN 3 38957155 missense probably damaging 1.00
IGL02996:Fat4 APN 3 38958525 missense probably damaging 1.00
IGL03029:Fat4 APN 3 38982591 missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38981552 missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38956859 missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38991685 missense probably damaging 1.00
IGL03169:Fat4 APN 3 38957398 missense probably benign 0.02
IGL03190:Fat4 APN 3 38981241 missense probably damaging 1.00
IGL03272:Fat4 APN 3 39009703 missense probably benign
IGL03371:Fat4 APN 3 38983187 missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38889134 missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38957227 missense probably damaging 1.00
IGL03394:Fat4 APN 3 38892019 missense probably damaging 0.99
IGL03394:Fat4 APN 3 39009364 missense probably damaging 1.00
IGL03405:Fat4 APN 3 38958450 missense probably benign 0.02
IGL03410:Fat4 APN 3 38891176 missense probably damaging 1.00
Asahi UTSW 3 38981819 missense probably damaging 1.00
Expulsion UTSW 3 38889649 missense probably benign 0.00
heineken UTSW 3 38980380 missense probably damaging 1.00
schlitz UTSW 3 38980659 missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 38889004 missense probably benign 0.04
PIT4696001:Fat4 UTSW 3 38982357 missense probably damaging 0.98
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0078:Fat4 UTSW 3 38888931 missense probably benign 0.35
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0201:Fat4 UTSW 3 38891596 missense probably damaging 0.99
R0280:Fat4 UTSW 3 38890816 missense probably benign
R0357:Fat4 UTSW 3 38891227 missense probably damaging 1.00
R0409:Fat4 UTSW 3 38977413 missense probably damaging 1.00
R0498:Fat4 UTSW 3 38980637 missense probably benign 0.00
R0502:Fat4 UTSW 3 39002924 missense probably damaging 0.98
R0506:Fat4 UTSW 3 38888314 missense probably benign 0.00
R0532:Fat4 UTSW 3 38981721 missense probably benign 0.02
R0616:Fat4 UTSW 3 38942870 missense probably damaging 1.00
R0630:Fat4 UTSW 3 39000172 missense probably damaging 1.00
R0678:Fat4 UTSW 3 38889694 missense probably damaging 1.00
R0685:Fat4 UTSW 3 39001178 missense probably benign
R0729:Fat4 UTSW 3 39000295 splice site probably benign
R0748:Fat4 UTSW 3 38887828 missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0812:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0830:Fat4 UTSW 3 38999109 missense probably benign 0.26
R0841:Fat4 UTSW 3 38995998 missense probably damaging 0.99
R0884:Fat4 UTSW 3 38982858 missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38891392 missense probably damaging 1.00
R1066:Fat4 UTSW 3 38957227 missense probably damaging 1.00
R1078:Fat4 UTSW 3 38983086 missense probably benign 0.10
R1084:Fat4 UTSW 3 38979825 missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38982942 missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38890371 missense probably benign 0.01
R1418:Fat4 UTSW 3 38890813 missense probably damaging 1.00
R1475:Fat4 UTSW 3 38888323 missense probably damaging 1.00
R1487:Fat4 UTSW 3 38995917 missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38983076 missense probably damaging 0.97
R1534:Fat4 UTSW 3 38890089 missense probably damaging 1.00
R1558:Fat4 UTSW 3 38888986 missense probably damaging 1.00
R1586:Fat4 UTSW 3 38888860 missense probably damaging 1.00
R1592:Fat4 UTSW 3 39007177 missense probably damaging 0.99
R1655:Fat4 UTSW 3 38957318 missense probably damaging 0.97
R1662:Fat4 UTSW 3 38980779 missense probably damaging 1.00
R1710:Fat4 UTSW 3 38951155 missense probably damaging 1.00
R1731:Fat4 UTSW 3 38891310 missense probably damaging 1.00
R1761:Fat4 UTSW 3 38887489 missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39010268 missense probably damaging 1.00
R1828:Fat4 UTSW 3 38983458 missense probably damaging 1.00
R1835:Fat4 UTSW 3 38983571 missense probably benign 0.00
R1846:Fat4 UTSW 3 38982383 missense probably benign 0.00
R1861:Fat4 UTSW 3 39010484 missense probably benign 0.09
R1871:Fat4 UTSW 3 38981072 missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38991664 missense probably damaging 1.00
R1988:Fat4 UTSW 3 38887115 missense probably benign
R1988:Fat4 UTSW 3 38996090 missense probably damaging 1.00
R2056:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39010655 missense probably benign 0.00
R2078:Fat4 UTSW 3 38889673 missense probably damaging 1.00
R2114:Fat4 UTSW 3 38981484 missense probably benign 0.01
R2135:Fat4 UTSW 3 38980733 missense probably damaging 0.98
R2152:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2153:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2154:Fat4 UTSW 3 38887539 missense probably damaging 1.00
R2196:Fat4 UTSW 3 38981417 missense probably benign 0.23
R2211:Fat4 UTSW 3 38891527 missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39010215 missense probably damaging 1.00
R2247:Fat4 UTSW 3 38892049 missense probably damaging 1.00
R2263:Fat4 UTSW 3 38888989 missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38890422 missense probably benign 0.25
R2274:Fat4 UTSW 3 38995899 missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38980011 missense probably damaging 1.00
R2343:Fat4 UTSW 3 38957105 missense probably damaging 0.97
R2365:Fat4 UTSW 3 38980419 missense probably benign
R2412:Fat4 UTSW 3 38957072 missense probably benign 0.05
R2883:Fat4 UTSW 3 38980804 missense probably damaging 1.00
R2942:Fat4 UTSW 3 38982336 missense probably damaging 1.00
R2989:Fat4 UTSW 3 39007153 missense probably benign
R3103:Fat4 UTSW 3 38891940 missense probably benign 0.03
R3158:Fat4 UTSW 3 38890791 missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38981274 missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38982438 missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3850:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3957:Fat4 UTSW 3 38982346 missense probably benign
R4065:Fat4 UTSW 3 39009197 missense probably benign 0.13
R4078:Fat4 UTSW 3 38980020 missense probably damaging 1.00
R4096:Fat4 UTSW 3 38887875 missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38942809 missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R4285:Fat4 UTSW 3 38889171 missense probably benign 0.00
R4288:Fat4 UTSW 3 38891763 missense probably damaging 1.00
R4407:Fat4 UTSW 3 38958540 missense probably benign 0.05
R4528:Fat4 UTSW 3 38891294 missense probably benign 0.01
R4547:Fat4 UTSW 3 38951283 missense probably damaging 1.00
R4681:Fat4 UTSW 3 38887342 missense probably damaging 1.00
R4826:Fat4 UTSW 3 38982957 missense probably damaging 1.00
R4855:Fat4 UTSW 3 38888317 missense probably benign
R4871:Fat4 UTSW 3 38891605 missense probably damaging 1.00
R4897:Fat4 UTSW 3 38980632 missense probably damaging 1.00
R4928:Fat4 UTSW 3 39010465 missense probably damaging 1.00
R4932:Fat4 UTSW 3 39007203 missense probably benign 0.00
R4941:Fat4 UTSW 3 38957452 missense probably damaging 1.00
R4943:Fat4 UTSW 3 38980173 missense probably benign 0.19
R4959:Fat4 UTSW 3 38983046 missense probably benign 0.00
R4973:Fat4 UTSW 3 38983046 missense probably benign 0.00
R5098:Fat4 UTSW 3 38888289 missense probably benign 0.34
R5163:Fat4 UTSW 3 38980797 missense probably damaging 1.00
R5213:Fat4 UTSW 3 38980191 missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38956868 missense probably damaging 1.00
R5337:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R5337:Fat4 UTSW 3 39010378 missense probably benign 0.44
R5363:Fat4 UTSW 3 38888005 missense probably damaging 1.00
R5380:Fat4 UTSW 3 38888864 missense probably damaging 1.00
R5422:Fat4 UTSW 3 38887245 missense possibly damaging 0.92
R5436:Fat4 UTSW 3 38891346 missense probably benign 0.00
R5443:Fat4 UTSW 3 39010370 missense probably damaging 1.00
R5501:Fat4 UTSW 3 38887215 missense probably benign 0.09
R5571:Fat4 UTSW 3 39010274 missense probably damaging 1.00
R5625:Fat4 UTSW 3 38888934 missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39002968 missense probably damaging 0.99
R5725:Fat4 UTSW 3 38889625 missense probably damaging 1.00
R5735:Fat4 UTSW 3 38949576 missense probably damaging 1.00
R5739:Fat4 UTSW 3 38983134 missense probably benign 0.01
R5766:Fat4 UTSW 3 38889468 missense probably damaging 1.00
R5780:Fat4 UTSW 3 38980955 missense probably damaging 0.96
R5811:Fat4 UTSW 3 38891787 missense probably damaging 1.00
R5829:Fat4 UTSW 3 39007305 missense probably damaging 1.00
R5879:Fat4 UTSW 3 38887336 missense probably benign
R5933:Fat4 UTSW 3 38951375 critical splice donor site probably null
R5938:Fat4 UTSW 3 38951239 missense probably damaging 1.00
R5940:Fat4 UTSW 3 38889649 missense probably benign 0.00
R5945:Fat4 UTSW 3 38983206 missense probably benign 0.19
R5963:Fat4 UTSW 3 39010547 missense probably damaging 1.00
R6077:Fat4 UTSW 3 39002802 missense probably damaging 1.00
R6158:Fat4 UTSW 3 38983262 missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38891721 missense probably damaging 1.00
R6253:Fat4 UTSW 3 38951356 missense probably damaging 0.99
R6259:Fat4 UTSW 3 39007246 missense probably benign 0.18
R6295:Fat4 UTSW 3 39007080 splice site probably null
R6387:Fat4 UTSW 3 38983785 missense probably damaging 1.00
R6390:Fat4 UTSW 3 38980380 missense probably damaging 1.00
R6456:Fat4 UTSW 3 38983979 missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38890887 missense probably damaging 1.00
R6500:Fat4 UTSW 3 38981269 nonsense probably null
R6503:Fat4 UTSW 3 38982257 missense probably benign 0.00
R6519:Fat4 UTSW 3 39002871 missense probably benign
R6566:Fat4 UTSW 3 38957126 missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38979690 missense probably benign
R6590:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6658:Fat4 UTSW 3 38942928 missense probably benign 0.01
R6662:Fat4 UTSW 3 38956821 missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6807:Fat4 UTSW 3 38982440 missense probably benign 0.18
R6823:Fat4 UTSW 3 38983939 missense probably benign 0.05
R6824:Fat4 UTSW 3 38957525 missense probably benign 0.00
R6830:Fat4 UTSW 3 38981817 missense probably benign 0.00
R6925:Fat4 UTSW 3 38996204 critical splice donor site probably null
R6948:Fat4 UTSW 3 39009446 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38981775 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38995971 missense probably damaging 1.00
R7017:Fat4 UTSW 3 38891543 missense probably benign
R7030:Fat4 UTSW 3 38981958 missense probably damaging 1.00
R7044:Fat4 UTSW 3 39010810 missense probably benign
R7044:Fat4 UTSW 3 39010811 missense probably benign 0.02
R7045:Fat4 UTSW 3 38888601 missense probably benign 0.01
R7094:Fat4 UTSW 3 38889874 missense probably damaging 1.00
R7111:Fat4 UTSW 3 39010533 missense probably damaging 1.00
R7130:Fat4 UTSW 3 38980787 missense probably damaging 0.99
R7168:Fat4 UTSW 3 38980659 missense probably damaging 1.00
R7192:Fat4 UTSW 3 38980464 missense probably benign 0.04
R7194:Fat4 UTSW 3 38888884 missense probably damaging 1.00
R7194:Fat4 UTSW 3 38983895 missense probably damaging 1.00
R7199:Fat4 UTSW 3 38977362 missense probably damaging 0.98
R7213:Fat4 UTSW 3 38999087 missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38891043 missense probably damaging 1.00
R7225:Fat4 UTSW 3 38980176 missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38890413 missense probably benign 0.31
R7239:Fat4 UTSW 3 38983840 missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38889693 missense probably damaging 1.00
R7296:Fat4 UTSW 3 38889145 nonsense probably null
R7372:Fat4 UTSW 3 38890209 missense probably damaging 1.00
R7400:Fat4 UTSW 3 38887924 missense probably damaging 1.00
R7419:Fat4 UTSW 3 39000236 missense probably damaging 1.00
R7430:Fat4 UTSW 3 38887450 missense probably damaging 0.97
R7430:Fat4 UTSW 3 39009644 missense probably damaging 1.00
R7431:Fat4 UTSW 3 39009157 missense possibly damaging 0.80
R7486:Fat4 UTSW 3 38957427 nonsense probably null
R7501:Fat4 UTSW 3 38958448 nonsense probably null
R7533:Fat4 UTSW 3 39007257 missense probably benign 0.43
R7542:Fat4 UTSW 3 38981355 missense possibly damaging 0.56
R7542:Fat4 UTSW 3 38981621 missense possibly damaging 0.64
R7548:Fat4 UTSW 3 38981114 missense probably benign 0.13
R7567:Fat4 UTSW 3 38889336 missense probably damaging 1.00
R7644:Fat4 UTSW 3 39010241 missense possibly damaging 0.64
R7660:Fat4 UTSW 3 38981160 missense probably benign
R7665:Fat4 UTSW 3 38889178 missense probably benign 0.00
R7676:Fat4 UTSW 3 38891697 missense probably damaging 0.98
R7832:Fat4 UTSW 3 39001204 missense probably benign 0.00
R7848:Fat4 UTSW 3 38887851 missense probably benign
R7883:Fat4 UTSW 3 38981819 missense probably damaging 1.00
R7892:Fat4 UTSW 3 38949439 critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38887541 missense probably damaging 1.00
R7952:Fat4 UTSW 3 38891721 missense probably damaging 0.98
R8015:Fat4 UTSW 3 38981916 missense possibly damaging 0.79
R8040:Fat4 UTSW 3 38981666 missense probably damaging 1.00
R8142:Fat4 UTSW 3 38891203 missense probably damaging 1.00
R8151:Fat4 UTSW 3 38892054 missense probably damaging 0.99
R8163:Fat4 UTSW 3 38979732 missense possibly damaging 0.88
R8317:Fat4 UTSW 3 38958510 missense possibly damaging 0.80
R8413:Fat4 UTSW 3 39008979 critical splice acceptor site probably null
R8447:Fat4 UTSW 3 38979675 missense possibly damaging 0.88
R8458:Fat4 UTSW 3 38981553 missense probably benign 0.25
R8509:Fat4 UTSW 3 38981903 missense probably benign
R8543:Fat4 UTSW 3 38977494 missense probably damaging 1.00
R8679:Fat4 UTSW 3 39010693 missense probably damaging 1.00
R8726:Fat4 UTSW 3 39010498 missense probably damaging 1.00
R8743:Fat4 UTSW 3 38888443 missense probably benign 0.16
R8751:Fat4 UTSW 3 38891853 missense probably benign 0.01
R8779:Fat4 UTSW 3 38979749 missense probably damaging 1.00
R8797:Fat4 UTSW 3 38999129 missense probably benign 0.01
R8860:Fat4 UTSW 3 38892120 missense probably benign 0.26
R8955:Fat4 UTSW 3 38983629 missense probably benign 0.01
R9053:Fat4 UTSW 3 38887175 nonsense probably null
R9071:Fat4 UTSW 3 38983449 missense probably benign 0.29
R9088:Fat4 UTSW 3 39007299 missense probably benign 0.02
R9100:Fat4 UTSW 3 39010654 missense
X0017:Fat4 UTSW 3 39009106 missense probably benign 0.00
X0019:Fat4 UTSW 3 38981040 missense probably damaging 1.00
X0020:Fat4 UTSW 3 39000151 missense probably damaging 1.00
X0024:Fat4 UTSW 3 38942902 missense probably benign 0.43
X0064:Fat4 UTSW 3 38970752 missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38887050 missense possibly damaging 0.88
Z1088:Fat4 UTSW 3 38958492 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983359 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983815 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38888584 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38890347 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38981838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTACAAGAATGGCAACTTCG -3'
(R):5'- GTGGTCAGTTTGTACGTCCC -3'

Sequencing Primer
(F):5'- GCAACTTCGGATAGCACTTG -3'
(R):5'- CCACTGCCCAGATTGTATGAG -3'
Posted On2016-08-04