Incidental Mutation 'R5384:Svep1'
Institutional Source Beutler Lab
Gene Symbol Svep1
Ensembl Gene ENSMUSG00000028369
Gene Namesushi, von Willebrand factor type A, EGF and pentraxin domain containing 1
SynonymsD430029O09Rik, 4833413O10Rik, Polydom, 1110021D17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5384 (G1)
Quality Score225
Status Not validated
Chromosomal Location58042442-58206859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58104545 bp
Amino Acid Change Lysine to Arginine at position 1226 (K1226R)
Ref Sequence ENSEMBL: ENSMUSP00000045856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042850]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042850
AA Change: K1226R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000045856
Gene: ENSMUSG00000028369
AA Change: K1226R

signal peptide 1 17 N/A INTRINSIC
low complexity region 51 60 N/A INTRINSIC
VWA 82 261 2.18e-32 SMART
Pfam:GCC2_GCC3 311 361 3.4e-14 PFAM
CCP 379 434 3.62e-8 SMART
CCP 439 494 1.78e-16 SMART
CCP 499 559 2.13e-5 SMART
Pfam:HYR 560 642 1.7e-20 PFAM
Pfam:HYR 643 722 4.6e-15 PFAM
CCP 727 787 3.59e-1 SMART
low complexity region 862 873 N/A INTRINSIC
Pfam:GCC2_GCC3 1004 1051 3.2e-16 PFAM
Pfam:GCC2_GCC3 1058 1105 5.4e-19 PFAM
Pfam:GCC2_GCC3 1112 1159 7.7e-19 PFAM
EGF 1195 1228 3.12e-7 SMART
EGF_CA 1230 1266 3.93e-13 SMART
EGF_CA 1268 1304 8.3e-12 SMART
EGF_CA 1306 1342 4.59e-14 SMART
EGF_CA 1344 1380 8.69e-15 SMART
EGF_CA 1382 1418 3.42e-13 SMART
Pfam:Pentaxin 1429 1622 1.8e-28 PFAM
Pfam:Laminin_G_3 1432 1589 1.1e-20 PFAM
CCP 1630 1684 1.71e-9 SMART
CCP 1689 1742 2.31e-15 SMART
EGF_CA 1744 1783 5.23e-9 SMART
CCP 1788 1841 4.62e-15 SMART
CCP 1846 1899 8.29e-17 SMART
CCP 1904 1957 1.1e-12 SMART
CCP 1962 2015 5.6e-14 SMART
CCP 2020 2077 4.15e-8 SMART
CCP 2082 2140 8.11e-11 SMART
CCP 2145 2198 4.38e-16 SMART
CCP 2203 2258 1.69e-8 SMART
CCP 2263 2317 1.42e-15 SMART
CCP 2322 2375 3.1e-7 SMART
CCP 2380 2434 4.55e-14 SMART
CCP 2439 2492 6.95e-10 SMART
CCP 2497 2550 8.88e-17 SMART
CCP 2555 2607 1.7e-13 SMART
CCP 2651 2709 1.02e-7 SMART
CCP 2714 2767 9.6e-13 SMART
CCP 2772 2825 3.64e-13 SMART
CCP 2830 2883 6.63e-16 SMART
CCP 2888 2941 2.76e-13 SMART
CCP 2946 2999 4.41e-12 SMART
CCP 3004 3055 4.25e-5 SMART
CCP 3060 3113 5.15e-13 SMART
CCP 3118 3172 2.11e-9 SMART
CCP 3177 3232 1.02e-7 SMART
CCP 3237 3290 6.19e-16 SMART
CCP 3295 3348 5.35e-11 SMART
CCP 3353 3407 8.43e-9 SMART
CCP 3412 3464 2.44e-14 SMART
EGF 3467 3496 1.28e-3 SMART
EGF 3499 3528 1.15e-5 SMART
EGF 3531 3560 2.85e-1 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete preweaning lethality, edema, abnormal skin coloration, thick epidermis, acanthosis, and tail/limb abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,960 V246A probably benign Het
Abcc10 T C 17: 46,304,435 S1343G possibly damaging Het
Abcd3 C A 3: 121,761,410 probably null Het
Actl6a T A 3: 32,720,493 M335K probably damaging Het
Adamts9 A C 6: 92,798,018 C1090W probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Apeh A T 9: 108,086,463 L551H probably damaging Het
Avpr1a T A 10: 122,449,369 F189I probably damaging Het
BC034090 T A 1: 155,242,027 H115L possibly damaging Het
C4b A T 17: 34,737,661 D654E possibly damaging Het
Carns1 T A 19: 4,171,901 probably null Het
Ccdc146 T A 5: 21,308,713 E469V probably benign Het
Cdc27 A G 11: 104,507,140 I804T probably benign Het
Cdh23 G A 10: 60,337,762 T1651I probably damaging Het
Cenpo G A 12: 4,216,646 P154L probably damaging Het
Cenpu G A 8: 46,562,499 G150R probably benign Het
Chrna10 C A 7: 102,114,353 L78F probably damaging Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cidea A T 18: 67,360,166 D85V probably damaging Het
Cldn18 T C 9: 99,709,858 S31G possibly damaging Het
Clpb T A 7: 101,779,341 I436N probably damaging Het
Col11a2 T C 17: 34,059,174 probably null Het
Cul7 T C 17: 46,654,477 V527A probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dchs1 T A 7: 105,772,055 D386V probably damaging Het
Dcstamp A C 15: 39,759,319 Q345H probably damaging Het
Dlgap3 A G 4: 127,236,330 I955V probably damaging Het
Dvl1 A G 4: 155,853,686 D97G probably damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Efr3b G T 12: 3,983,419 F129L probably benign Het
Etaa1 G A 11: 17,947,539 L193F probably damaging Het
Fam13c G A 10: 70,553,069 S474N probably benign Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fastkd3 T C 13: 68,584,585 F342L probably benign Het
Fat4 T C 3: 38,995,946 S3986P possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fgr G A 4: 132,986,353 probably null Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gm20671 A G 5: 32,819,942 S1823P probably damaging Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gsdma A T 11: 98,666,449 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac9 A G 12: 34,429,558 Y223H probably damaging Het
Igsf5 C A 16: 96,391,026 T275N probably benign Het
Il23r G A 6: 67,486,291 H73Y probably benign Het
Ipo4 G T 14: 55,626,196 R1026S probably benign Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Khdrbs1 G T 4: 129,741,936 D75E possibly damaging Het
Lrwd1 A T 5: 136,123,874 D511E possibly damaging Het
Ly75 A T 2: 60,334,487 C782* probably null Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myof C T 19: 37,952,987 A792T probably damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Ncoa7 C A 10: 30,722,817 A37S probably benign Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Nr1d2 A T 14: 18,211,922 S394T probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1252 T A 2: 89,721,305 I269F possibly damaging Het
Olfr1508 T A 14: 52,463,257 T251S probably benign Het
Olfr165 A G 16: 19,407,797 L73P probably damaging Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Pate2 A G 9: 35,670,541 M44V probably damaging Het
Pikfyve T C 1: 65,244,409 L735S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld1 C A 3: 28,025,320 R90S probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppm1d A G 11: 85,311,783 E104G probably damaging Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Ppp1r42 A G 1: 9,999,435 L134P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss36 C A 7: 127,936,699 R288L probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Psma3 G T 12: 70,974,765 G7W probably damaging Het
Psmc3ip A T 11: 101,092,604 probably null Het
Qser1 T C 2: 104,786,642 E1275G probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rcc2 A T 4: 140,720,566 K468* probably null Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sec1 C A 7: 45,678,840 R261L probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Homo
Sgip1 G A 4: 102,934,566 V362I possibly damaging Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc12a9 A T 5: 137,331,014 L126Q probably damaging Het
Slx4 A G 16: 3,990,805 S424P probably damaging Het
Smg5 T C 3: 88,351,293 S524P probably damaging Het
Sncaip A G 18: 52,885,041 D418G probably damaging Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Spata31d1b C A 13: 59,718,218 T1060K possibly damaging Het
Spink6 A G 18: 44,082,280 T66A probably damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stk39 T A 2: 68,410,039 D116V probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tas2r117 G T 6: 132,803,154 S85I probably benign Het
Tcf20 T A 15: 82,856,199 Q350H probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfb2m A C 1: 179,545,872 probably null Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Trappc8 A T 18: 20,833,062 probably null Het
Trbv30 A G 6: 41,281,920 T88A probably benign Het
Trim40 T A 17: 36,888,865 N107I probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Ttn A G 2: 76,878,348 probably benign Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn1r42 T A 6: 89,845,384 I68F probably damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa7 G T 17: 35,024,926 probably null Het
Xndc1 T C 7: 102,082,188 V378A probably benign Het
Zc3h12d A T 10: 7,853,250 D126V probably damaging Het
Zc3h13 A G 14: 75,343,619 N1682S probably benign Het
Zc3h15 T C 2: 83,660,230 I236T possibly damaging Het
Zfp13 A T 17: 23,581,182 I34N probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfyve28 A G 5: 34,216,967 C568R probably damaging Het
Other mutations in Svep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Svep1 APN 4 58176077 missense probably damaging 0.98
IGL00489:Svep1 APN 4 58068988 missense possibly damaging 0.71
IGL00496:Svep1 APN 4 58069001 missense possibly damaging 0.95
IGL00864:Svep1 APN 4 58068533 nonsense probably null
IGL00904:Svep1 APN 4 58097398 missense probably benign 0.00
IGL00935:Svep1 APN 4 58090664 missense possibly damaging 0.71
IGL00963:Svep1 APN 4 58072791 nonsense probably null
IGL01077:Svep1 APN 4 58068760 missense possibly damaging 0.71
IGL01084:Svep1 APN 4 58111419 missense possibly damaging 0.71
IGL01150:Svep1 APN 4 58070302 missense probably benign 0.04
IGL01161:Svep1 APN 4 58146569 missense probably damaging 0.96
IGL01360:Svep1 APN 4 58116554 missense possibly damaging 0.73
IGL01365:Svep1 APN 4 58100878 critical splice acceptor site probably null
IGL01396:Svep1 APN 4 58068552 missense possibly damaging 0.85
IGL01601:Svep1 APN 4 58084872 missense probably damaging 1.00
IGL01636:Svep1 APN 4 58116622 missense possibly damaging 0.96
IGL01838:Svep1 APN 4 58121910 missense possibly damaging 0.72
IGL01949:Svep1 APN 4 58176006 missense probably damaging 1.00
IGL01984:Svep1 APN 4 58068877 missense possibly damaging 0.93
IGL02005:Svep1 APN 4 58069056 missense possibly damaging 0.93
IGL02036:Svep1 APN 4 58088245 missense possibly damaging 0.85
IGL02039:Svep1 APN 4 58123980 critical splice donor site probably null
IGL02043:Svep1 APN 4 58068556 missense probably benign 0.19
IGL02073:Svep1 APN 4 58070104 missense probably benign 0.06
IGL02188:Svep1 APN 4 58068382 missense possibly damaging 0.71
IGL02256:Svep1 APN 4 58070311 missense possibly damaging 0.71
IGL02284:Svep1 APN 4 58072819 missense probably benign 0.32
IGL02323:Svep1 APN 4 58070236 nonsense probably null
IGL02440:Svep1 APN 4 58145293 missense probably benign 0.06
IGL02449:Svep1 APN 4 58070296 missense possibly damaging 0.71
IGL02501:Svep1 APN 4 58145341 splice site probably benign
IGL02568:Svep1 APN 4 58135441 missense probably benign 0.42
IGL02625:Svep1 APN 4 58115807 missense possibly damaging 0.53
IGL02795:Svep1 APN 4 58123223 missense probably damaging 1.00
IGL02818:Svep1 APN 4 58069804 missense possibly damaging 0.71
IGL02871:Svep1 APN 4 58100871 missense probably benign
IGL02875:Svep1 APN 4 58082821 splice site probably benign
IGL02887:Svep1 APN 4 58145301 missense probably damaging 1.00
IGL03240:Svep1 APN 4 58048188 missense possibly damaging 0.73
IGL03243:Svep1 APN 4 58133387 missense probably benign 0.06
IGL03264:Svep1 APN 4 58066422 splice site probably benign
IGL03288:Svep1 APN 4 58116532 missense probably benign 0.01
IGL03340:Svep1 APN 4 58111451 missense possibly damaging 0.96
IGL03341:Svep1 APN 4 58070308 nonsense probably null
IGL03348:Svep1 APN 4 58113635 missense probably damaging 1.00
R0001:Svep1 UTSW 4 58066460 missense possibly damaging 0.93
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0042:Svep1 UTSW 4 58123192 missense possibly damaging 0.92
R0125:Svep1 UTSW 4 58099937 splice site probably benign
R0142:Svep1 UTSW 4 58118232 missense probably benign 0.33
R0147:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0148:Svep1 UTSW 4 58116608 missense possibly damaging 0.85
R0157:Svep1 UTSW 4 58069830 missense possibly damaging 0.72
R0195:Svep1 UTSW 4 58089514 missense possibly damaging 0.82
R0197:Svep1 UTSW 4 58070851 missense possibly damaging 0.71
R0257:Svep1 UTSW 4 58179610 missense possibly damaging 0.71
R0314:Svep1 UTSW 4 58096331 missense possibly damaging 0.71
R0316:Svep1 UTSW 4 58072737 missense probably damaging 0.98
R0322:Svep1 UTSW 4 58057996 splice site probably benign
R0426:Svep1 UTSW 4 58073333 missense possibly damaging 0.87
R0446:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R0457:Svep1 UTSW 4 58118136 missense probably damaging 1.00
R0471:Svep1 UTSW 4 58054700 missense possibly damaging 0.85
R0555:Svep1 UTSW 4 58128858 missense possibly damaging 0.71
R0634:Svep1 UTSW 4 58070661 missense possibly damaging 0.86
R0636:Svep1 UTSW 4 58073121 nonsense probably null
R0827:Svep1 UTSW 4 58053113 splice site probably benign
R1025:Svep1 UTSW 4 58087817 missense possibly damaging 0.86
R1027:Svep1 UTSW 4 58094084 missense possibly damaging 0.86
R1069:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1161:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1245:Svep1 UTSW 4 58066427 critical splice donor site probably null
R1282:Svep1 UTSW 4 58100032 missense possibly damaging 0.93
R1310:Svep1 UTSW 4 58069416 missense possibly damaging 0.71
R1444:Svep1 UTSW 4 58115754 missense possibly damaging 0.53
R1460:Svep1 UTSW 4 58068740 missense possibly damaging 0.85
R1500:Svep1 UTSW 4 58070239 missense probably damaging 1.00
R1628:Svep1 UTSW 4 58107561 missense probably benign 0.00
R1712:Svep1 UTSW 4 58070629 missense probably benign 0.06
R1774:Svep1 UTSW 4 58146562 missense possibly damaging 0.92
R1783:Svep1 UTSW 4 58073333 missense probably benign
R1829:Svep1 UTSW 4 58096310 missense possibly damaging 0.93
R1978:Svep1 UTSW 4 58097292 missense possibly damaging 0.73
R1993:Svep1 UTSW 4 58064170 critical splice donor site probably null
R2017:Svep1 UTSW 4 58070568 missense probably benign 0.08
R2058:Svep1 UTSW 4 58084554 missense possibly damaging 0.92
R2109:Svep1 UTSW 4 58206030 missense possibly damaging 0.51
R2215:Svep1 UTSW 4 58138602 splice site probably benign
R2281:Svep1 UTSW 4 58082677 missense possibly damaging 0.85
R2504:Svep1 UTSW 4 58135628 splice site probably null
R2763:Svep1 UTSW 4 58084061 missense possibly damaging 0.86
R3122:Svep1 UTSW 4 58087845 missense possibly damaging 0.51
R3605:Svep1 UTSW 4 58066542 missense probably benign 0.32
R3763:Svep1 UTSW 4 58084833 missense possibly damaging 0.89
R3827:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3829:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3830:Svep1 UTSW 4 58096177 missense probably damaging 0.98
R3910:Svep1 UTSW 4 58145156 critical splice donor site probably null
R3943:Svep1 UTSW 4 58084807 splice site probably null
R3944:Svep1 UTSW 4 58084807 splice site probably null
R4153:Svep1 UTSW 4 58089426 missense possibly damaging 0.52
R4154:Svep1 UTSW 4 58069068 missense possibly damaging 0.71
R4191:Svep1 UTSW 4 58046601 missense possibly damaging 0.86
R4355:Svep1 UTSW 4 58138695 missense possibly damaging 0.71
R4388:Svep1 UTSW 4 58069249 missense possibly damaging 0.93
R4532:Svep1 UTSW 4 58068886 missense possibly damaging 0.52
R4584:Svep1 UTSW 4 58068526 nonsense probably null
R4592:Svep1 UTSW 4 58084028 missense possibly damaging 0.93
R4593:Svep1 UTSW 4 58091944 missense possibly damaging 0.71
R4625:Svep1 UTSW 4 58072698 missense probably damaging 0.98
R4639:Svep1 UTSW 4 58082724 missense probably benign
R4700:Svep1 UTSW 4 58097323 missense possibly damaging 0.71
R4720:Svep1 UTSW 4 58205869 missense possibly damaging 0.71
R4724:Svep1 UTSW 4 58070752 missense possibly damaging 0.71
R4753:Svep1 UTSW 4 58053212 missense probably benign 0.06
R4781:Svep1 UTSW 4 58070340 missense probably damaging 0.98
R4820:Svep1 UTSW 4 58082664 missense probably benign 0.27
R4896:Svep1 UTSW 4 58087751 missense probably benign 0.08
R4905:Svep1 UTSW 4 58069308 missense probably benign 0.00
R4910:Svep1 UTSW 4 58096276 missense possibly damaging 0.71
R4972:Svep1 UTSW 4 58087778 missense possibly damaging 0.71
R5004:Svep1 UTSW 4 58087751 missense probably benign 0.08
R5088:Svep1 UTSW 4 58120648 missense possibly damaging 0.73
R5112:Svep1 UTSW 4 58068610 nonsense probably null
R5185:Svep1 UTSW 4 58084534 missense probably damaging 0.99
R5302:Svep1 UTSW 4 58096183 missense possibly damaging 0.71
R5307:Svep1 UTSW 4 58072677 missense possibly damaging 0.71
R5339:Svep1 UTSW 4 58121892 missense possibly damaging 0.96
R5379:Svep1 UTSW 4 58072991 missense possibly damaging 0.51
R5414:Svep1 UTSW 4 58206322 missense possibly damaging 0.53
R5514:Svep1 UTSW 4 58044054 missense possibly damaging 0.53
R5538:Svep1 UTSW 4 58049282 critical splice acceptor site probably null
R5549:Svep1 UTSW 4 58057954 missense probably benign 0.32
R5618:Svep1 UTSW 4 58070537 missense probably benign
R5623:Svep1 UTSW 4 58091964 missense possibly damaging 0.92
R5686:Svep1 UTSW 4 58072826 missense possibly damaging 0.71
R5743:Svep1 UTSW 4 58096223 missense possibly damaging 0.71
R5773:Svep1 UTSW 4 58099985 missense possibly damaging 0.86
R5809:Svep1 UTSW 4 58116524 missense possibly damaging 0.73
R5896:Svep1 UTSW 4 58084906 missense possibly damaging 0.71
R5918:Svep1 UTSW 4 58069345 missense possibly damaging 0.71
R5969:Svep1 UTSW 4 58070977 nonsense probably null
R6010:Svep1 UTSW 4 58115832 missense possibly damaging 0.95
R6187:Svep1 UTSW 4 58072872 missense probably damaging 1.00
R6192:Svep1 UTSW 4 58104536 missense possibly damaging 0.92
R6209:Svep1 UTSW 4 58128869 missense probably benign 0.32
R6234:Svep1 UTSW 4 58113458 intron probably null
R6326:Svep1 UTSW 4 58073045 missense possibly damaging 0.51
R6400:Svep1 UTSW 4 58049169 missense probably damaging 1.00
R6418:Svep1 UTSW 4 58053126 missense probably benign 0.01
R6440:Svep1 UTSW 4 58116555 missense possibly damaging 0.53
R6489:Svep1 UTSW 4 58100066 missense probably damaging 1.00
R6515:Svep1 UTSW 4 58088280 missense probably damaging 1.00
R6738:Svep1 UTSW 4 58123180 missense possibly damaging 0.71
R6773:Svep1 UTSW 4 58049146 missense possibly damaging 0.71
R6796:Svep1 UTSW 4 58064275 missense probably benign 0.01
R7055:Svep1 UTSW 4 58064275 missense probably benign 0.19
R7055:Svep1 UTSW 4 58120642 missense probably benign 0.33
R7111:Svep1 UTSW 4 58118207 missense possibly damaging 0.70
R7161:Svep1 UTSW 4 58128859 missense possibly damaging 0.93
R7162:Svep1 UTSW 4 58070262 missense possibly damaging 0.71
R7182:Svep1 UTSW 4 58043991 missense probably benign 0.18
R7292:Svep1 UTSW 4 58111395 missense possibly damaging 0.71
R7299:Svep1 UTSW 4 58046587 nonsense probably null
R7301:Svep1 UTSW 4 58046587 nonsense probably null
R7316:Svep1 UTSW 4 58068763 missense possibly damaging 0.71
R7337:Svep1 UTSW 4 58108323 missense probably damaging 0.98
R7391:Svep1 UTSW 4 58145185 missense probably damaging 0.98
R7402:Svep1 UTSW 4 58069699 missense possibly damaging 0.71
R7445:Svep1 UTSW 4 58094122 missense possibly damaging 0.85
R7450:Svep1 UTSW 4 58064248 missense possibly damaging 0.71
R7492:Svep1 UTSW 4 58066468 missense possibly damaging 0.51
R7505:Svep1 UTSW 4 58115862 missense possibly damaging 0.53
R7509:Svep1 UTSW 4 58090683 missense probably benign 0.40
R7538:Svep1 UTSW 4 58053260 missense possibly damaging 0.71
R7555:Svep1 UTSW 4 58069422 missense probably damaging 0.98
R7660:Svep1 UTSW 4 58087782 missense probably benign 0.32
R7670:Svep1 UTSW 4 58097424 missense probably damaging 1.00
R7719:Svep1 UTSW 4 58068523 missense probably damaging 0.97
R7733:Svep1 UTSW 4 58049239 missense probably benign 0.03
X0063:Svep1 UTSW 4 58070468 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-08-04