Incidental Mutation 'R5384:Lrwd1'
ID424920
Institutional Source Beutler Lab
Gene Symbol Lrwd1
Ensembl Gene ENSMUSG00000029703
Gene Nameleucine-rich repeats and WD repeat domain containing 1
Synonyms1200011O22Rik, Orca
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.840) question?
Stock #R5384 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location136122772-136136074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136123874 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 511 (D511E)
Ref Sequence ENSEMBL: ENSMUSP00000006301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006301] [ENSMUST00000041366] [ENSMUST00000111127] [ENSMUST00000111129]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006301
AA Change: D511E

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006301
Gene: ENSMUSG00000029703
AA Change: D511E

DomainStartEndE-ValueType
low complexity region 25 38 N/A INTRINSIC
LRR_TYP 46 69 3.16e-3 SMART
LRR 90 113 1.58e2 SMART
WD40 271 327 6.36e1 SMART
Blast:WD40 330 380 2e-12 BLAST
WD40 383 423 1.49e-7 SMART
WD40 434 473 2.28e2 SMART
Blast:WD40 484 527 6e-15 BLAST
WD40 542 583 1.42e2 SMART
low complexity region 591 602 N/A INTRINSIC
Blast:WD40 603 646 8e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000041366
SMART Domains Protein: ENSMUSP00000038505
Gene: ENSMUSG00000039771

DomainStartEndE-ValueType
Pfam:RNA_pol_L_2 30 104 5.3e-32 PFAM
Pfam:RNA_pol_L 32 98 4.2e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111127
SMART Domains Protein: ENSMUSP00000106757
Gene: ENSMUSG00000039771

DomainStartEndE-ValueType
Pfam:RNA_pol_L_2 29 105 3.6e-33 PFAM
Pfam:RNA_pol_L 31 99 1.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111129
SMART Domains Protein: ENSMUSP00000106759
Gene: ENSMUSG00000039771

DomainStartEndE-ValueType
Pfam:RNA_pol_L 17 69 2.7e-9 PFAM
Pfam:RNA_pol_L_2 17 75 1.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128255
AA Change: D38E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119546
Gene: ENSMUSG00000029703
AA Change: D38E

DomainStartEndE-ValueType
Blast:WD40 13 66 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199799
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with components of the origin recognition complex (ORC) and regulates the formation of the prereplicative complex. The encoded protein stabilizes the ORC and therefore aids in DNA replication. This protein is required for the G1/S phase transition of the cell cycle. In addition, the encoded protein binds to trimethylated histone H3 in heterochromatin and recruits the ORC and lysine methyltransferases, which help maintain the repressive heterochromatic state. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,960 V246A probably benign Het
Abcc10 T C 17: 46,304,435 S1343G possibly damaging Het
Abcd3 C A 3: 121,761,410 probably null Het
Actl6a T A 3: 32,720,493 M335K probably damaging Het
Adamts9 A C 6: 92,798,018 C1090W probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Apeh A T 9: 108,086,463 L551H probably damaging Het
Avpr1a T A 10: 122,449,369 F189I probably damaging Het
BC034090 T A 1: 155,242,027 H115L possibly damaging Het
C4b A T 17: 34,737,661 D654E possibly damaging Het
Carns1 T A 19: 4,171,901 probably null Het
Ccdc146 T A 5: 21,308,713 E469V probably benign Het
Cdc27 A G 11: 104,507,140 I804T probably benign Het
Cdh23 G A 10: 60,337,762 T1651I probably damaging Het
Cenpo G A 12: 4,216,646 P154L probably damaging Het
Cenpu G A 8: 46,562,499 G150R probably benign Het
Chrna10 C A 7: 102,114,353 L78F probably damaging Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cidea A T 18: 67,360,166 D85V probably damaging Het
Cldn18 T C 9: 99,709,858 S31G possibly damaging Het
Clpb T A 7: 101,779,341 I436N probably damaging Het
Col11a2 T C 17: 34,059,174 probably null Het
Cul7 T C 17: 46,654,477 V527A probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dchs1 T A 7: 105,772,055 D386V probably damaging Het
Dcstamp A C 15: 39,759,319 Q345H probably damaging Het
Dlgap3 A G 4: 127,236,330 I955V probably damaging Het
Dvl1 A G 4: 155,853,686 D97G probably damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Efr3b G T 12: 3,983,419 F129L probably benign Het
Etaa1 G A 11: 17,947,539 L193F probably damaging Het
Fam13c G A 10: 70,553,069 S474N probably benign Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fastkd3 T C 13: 68,584,585 F342L probably benign Het
Fat4 T C 3: 38,995,946 S3986P possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fgr G A 4: 132,986,353 probably null Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gm20671 A G 5: 32,819,942 S1823P probably damaging Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gsdma A T 11: 98,666,449 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac9 A G 12: 34,429,558 Y223H probably damaging Het
Igsf5 C A 16: 96,391,026 T275N probably benign Het
Il23r G A 6: 67,486,291 H73Y probably benign Het
Ipo4 G T 14: 55,626,196 R1026S probably benign Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Khdrbs1 G T 4: 129,741,936 D75E possibly damaging Het
Ly75 A T 2: 60,334,487 C782* probably null Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myof C T 19: 37,952,987 A792T probably damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Ncoa7 C A 10: 30,722,817 A37S probably benign Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Nr1d2 A T 14: 18,211,922 S394T probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1252 T A 2: 89,721,305 I269F possibly damaging Het
Olfr1508 T A 14: 52,463,257 T251S probably benign Het
Olfr165 A G 16: 19,407,797 L73P probably damaging Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Pate2 A G 9: 35,670,541 M44V probably damaging Het
Pikfyve T C 1: 65,244,409 L735S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld1 C A 3: 28,025,320 R90S probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppm1d A G 11: 85,311,783 E104G probably damaging Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Ppp1r42 A G 1: 9,999,435 L134P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss36 C A 7: 127,936,699 R288L probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Psma3 G T 12: 70,974,765 G7W probably damaging Het
Psmc3ip A T 11: 101,092,604 probably null Het
Qser1 T C 2: 104,786,642 E1275G probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rcc2 A T 4: 140,720,566 K468* probably null Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sec1 C A 7: 45,678,840 R261L probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Homo
Sgip1 G A 4: 102,934,566 V362I possibly damaging Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc12a9 A T 5: 137,331,014 L126Q probably damaging Het
Slx4 A G 16: 3,990,805 S424P probably damaging Het
Smg5 T C 3: 88,351,293 S524P probably damaging Het
Sncaip A G 18: 52,885,041 D418G probably damaging Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Spata31d1b C A 13: 59,718,218 T1060K possibly damaging Het
Spink6 A G 18: 44,082,280 T66A probably damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stk39 T A 2: 68,410,039 D116V probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Svep1 T C 4: 58,104,545 K1226R possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tas2r117 G T 6: 132,803,154 S85I probably benign Het
Tcf20 T A 15: 82,856,199 Q350H probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfb2m A C 1: 179,545,872 probably null Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Trappc8 A T 18: 20,833,062 probably null Het
Trbv30 A G 6: 41,281,920 T88A probably benign Het
Trim40 T A 17: 36,888,865 N107I probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Ttn A G 2: 76,878,348 probably benign Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn1r42 T A 6: 89,845,384 I68F probably damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa7 G T 17: 35,024,926 probably null Het
Xndc1 T C 7: 102,082,188 V378A probably benign Het
Zc3h12d A T 10: 7,853,250 D126V probably damaging Het
Zc3h13 A G 14: 75,343,619 N1682S probably benign Het
Zc3h15 T C 2: 83,660,230 I236T possibly damaging Het
Zfp13 A T 17: 23,581,182 I34N probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfyve28 A G 5: 34,216,967 C568R probably damaging Het
Other mutations in Lrwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01593:Lrwd1 APN 5 136134629 missense probably damaging 1.00
IGL01827:Lrwd1 APN 5 136131518 nonsense probably null
IGL01919:Lrwd1 APN 5 136135875 nonsense probably null
IGL02327:Lrwd1 APN 5 136123464 missense probably damaging 1.00
R0614:Lrwd1 UTSW 5 136123500 missense probably damaging 0.99
R0882:Lrwd1 UTSW 5 136123400 splice site probably null
R1137:Lrwd1 UTSW 5 136133419 missense probably benign 0.01
R1164:Lrwd1 UTSW 5 136130990 missense probably benign 0.00
R1302:Lrwd1 UTSW 5 136132413 missense probably benign 0.05
R1838:Lrwd1 UTSW 5 136132388 missense probably benign 0.00
R2114:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2116:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R2117:Lrwd1 UTSW 5 136130478 missense probably damaging 1.00
R4514:Lrwd1 UTSW 5 136131548 missense probably benign 0.00
R4595:Lrwd1 UTSW 5 136123956 missense probably benign
R5304:Lrwd1 UTSW 5 136131150 missense possibly damaging 0.49
R5719:Lrwd1 UTSW 5 136132239 splice site probably null
R5771:Lrwd1 UTSW 5 136123662 missense possibly damaging 0.95
R5791:Lrwd1 UTSW 5 136131033 missense probably benign 0.44
R6431:Lrwd1 UTSW 5 136133034 missense possibly damaging 0.90
R7074:Lrwd1 UTSW 5 136123657 missense probably benign 0.01
R7132:Lrwd1 UTSW 5 136123275 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGACTACGGGCAACACAGAC -3'
(R):5'- GCATCTTCTGGCCTACAACC -3'

Sequencing Primer
(F):5'- CGGCCTGCCCATGTCTG -3'
(R):5'- TCTGGCCTACAACCCTGGATG -3'
Posted On2016-08-04