Incidental Mutation 'R5384:Adamts9'
ID424925
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9
Synonyms8430403M15Rik, E030027K14Rik, 1810011L16Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5384 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location92772699-92943492 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 92798018 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 1090 (C1090W)
Ref Sequence ENSEMBL: ENSMUSP00000126498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438] [ENSMUST00000167391]
Predicted Effect probably damaging
Transcript: ENSMUST00000113438
AA Change: C1671W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: C1671W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125490
Predicted Effect probably damaging
Transcript: ENSMUST00000167391
AA Change: C1090W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126498
Gene: ENSMUSG00000030022
AA Change: C1090W

DomainStartEndE-ValueType
TSP1 10 62 2.15e-9 SMART
Pfam:ADAM_spacer1 172 290 6.1e-35 PFAM
TSP1 300 355 1.14e0 SMART
Blast:TSP1 357 412 3e-28 BLAST
TSP1 419 473 3.78e-5 SMART
TSP1 474 528 5.64e-4 SMART
TSP1 529 585 1.25e-5 SMART
TSP1 605 659 1.45e-6 SMART
TSP1 661 715 4.41e-6 SMART
TSP1 747 799 7.06e-5 SMART
TSP1 800 855 4.24e-8 SMART
TSP1 859 914 8.23e-6 SMART
TSP1 915 970 1.23e-4 SMART
TSP1 971 1028 2e-4 SMART
TSP1 1030 1091 1.25e-5 SMART
TSP1 1095 1149 3.47e-4 SMART
Pfam:GON 1150 1350 2.1e-86 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 126 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,469,960 V246A probably benign Het
Abcc10 T C 17: 46,304,435 S1343G possibly damaging Het
Abcd3 C A 3: 121,761,410 probably null Het
Actl6a T A 3: 32,720,493 M335K probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Apeh A T 9: 108,086,463 L551H probably damaging Het
Avpr1a T A 10: 122,449,369 F189I probably damaging Het
BC034090 T A 1: 155,242,027 H115L possibly damaging Het
C4b A T 17: 34,737,661 D654E possibly damaging Het
Carns1 T A 19: 4,171,901 probably null Het
Ccdc146 T A 5: 21,308,713 E469V probably benign Het
Cdc27 A G 11: 104,507,140 I804T probably benign Het
Cdh23 G A 10: 60,337,762 T1651I probably damaging Het
Cenpo G A 12: 4,216,646 P154L probably damaging Het
Cenpu G A 8: 46,562,499 G150R probably benign Het
Chrna10 C A 7: 102,114,353 L78F probably damaging Het
Chrne A T 11: 70,615,087 N457K possibly damaging Het
Cidea A T 18: 67,360,166 D85V probably damaging Het
Cldn18 T C 9: 99,709,858 S31G possibly damaging Het
Clpb T A 7: 101,779,341 I436N probably damaging Het
Col11a2 T C 17: 34,059,174 probably null Het
Cul7 T C 17: 46,654,477 V527A probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dchs1 T A 7: 105,772,055 D386V probably damaging Het
Dcstamp A C 15: 39,759,319 Q345H probably damaging Het
Dlgap3 A G 4: 127,236,330 I955V probably damaging Het
Dvl1 A G 4: 155,853,686 D97G probably damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Efr3b G T 12: 3,983,419 F129L probably benign Het
Etaa1 G A 11: 17,947,539 L193F probably damaging Het
Fam13c G A 10: 70,553,069 S474N probably benign Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fastkd3 T C 13: 68,584,585 F342L probably benign Het
Fat4 T C 3: 38,995,946 S3986P possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fgr G A 4: 132,986,353 probably null Het
Gbx2 T C 1: 89,928,913 T252A probably damaging Het
Gm20671 A G 5: 32,819,942 S1823P probably damaging Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gsdma A T 11: 98,666,449 probably null Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac9 A G 12: 34,429,558 Y223H probably damaging Het
Igsf5 C A 16: 96,391,026 T275N probably benign Het
Il23r G A 6: 67,486,291 H73Y probably benign Het
Ipo4 G T 14: 55,626,196 R1026S probably benign Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Khdrbs1 G T 4: 129,741,936 D75E possibly damaging Het
Lrwd1 A T 5: 136,123,874 D511E possibly damaging Het
Ly75 A T 2: 60,334,487 C782* probably null Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myh10 T A 11: 68,801,608 L1369Q probably damaging Het
Myof C T 19: 37,952,987 A792T probably damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Ncoa7 C A 10: 30,722,817 A37S probably benign Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nmur2 T A 11: 56,040,214 I224F probably damaging Het
Nr1d2 A T 14: 18,211,922 S394T probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1252 T A 2: 89,721,305 I269F possibly damaging Het
Olfr1508 T A 14: 52,463,257 T251S probably benign Het
Olfr165 A G 16: 19,407,797 L73P probably damaging Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Pate2 A G 9: 35,670,541 M44V probably damaging Het
Pikfyve T C 1: 65,244,409 L735S probably damaging Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld1 C A 3: 28,025,320 R90S probably damaging Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppm1d A G 11: 85,311,783 E104G probably damaging Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Ppp1r42 A G 1: 9,999,435 L134P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss36 C A 7: 127,936,699 R288L probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Psma3 G T 12: 70,974,765 G7W probably damaging Het
Psmc3ip A T 11: 101,092,604 probably null Het
Qser1 T C 2: 104,786,642 E1275G probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Rcc2 A T 4: 140,720,566 K468* probably null Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sec1 C A 7: 45,678,840 R261L probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Homo
Sgip1 G A 4: 102,934,566 V362I possibly damaging Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc12a9 A T 5: 137,331,014 L126Q probably damaging Het
Slx4 A G 16: 3,990,805 S424P probably damaging Het
Smg5 T C 3: 88,351,293 S524P probably damaging Het
Sncaip A G 18: 52,885,041 D418G probably damaging Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Spata31d1b C A 13: 59,718,218 T1060K possibly damaging Het
Spink6 A G 18: 44,082,280 T66A probably damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stk39 T A 2: 68,410,039 D116V probably damaging Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Svep1 T C 4: 58,104,545 K1226R possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tas2r117 G T 6: 132,803,154 S85I probably benign Het
Tcf20 T A 15: 82,856,199 Q350H probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfb2m A C 1: 179,545,872 probably null Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Trappc8 A T 18: 20,833,062 probably null Het
Trbv30 A G 6: 41,281,920 T88A probably benign Het
Trim40 T A 17: 36,888,865 N107I probably damaging Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Ttn A G 2: 76,878,348 probably benign Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn1r42 T A 6: 89,845,384 I68F probably damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa7 G T 17: 35,024,926 probably null Het
Xndc1 T C 7: 102,082,188 V378A probably benign Het
Zc3h12d A T 10: 7,853,250 D126V probably damaging Het
Zc3h13 A G 14: 75,343,619 N1682S probably benign Het
Zc3h15 T C 2: 83,660,230 I236T possibly damaging Het
Zfp13 A T 17: 23,581,182 I34N probably damaging Het
Zfp169 A T 13: 48,490,275 C459S possibly damaging Het
Zfyve28 A G 5: 34,216,967 C568R probably damaging Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92859902 missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92860174 missense probably benign 0.00
IGL01462:Adamts9 APN 6 92894266 missense probably benign 0.04
IGL01551:Adamts9 APN 6 92807020 missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92858147 splice site probably benign
IGL01638:Adamts9 APN 6 92872428 missense probably benign 0.19
IGL01757:Adamts9 APN 6 92796159 missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92777439 missense probably benign 0.00
IGL02379:Adamts9 APN 6 92797033 missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92796997 missense probably benign 0.04
IGL02554:Adamts9 APN 6 92880847 missense probably benign 0.01
IGL02832:Adamts9 APN 6 92807175 missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92889937 missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92887432 nonsense probably null
IGL03401:Adamts9 APN 6 92786868 missense probably damaging 0.97
Bluebeard UTSW 6 92879959 nonsense probably null
PIT4402001:Adamts9 UTSW 6 92872347 missense probably benign
PIT4458001:Adamts9 UTSW 6 92889905 missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0047:Adamts9 UTSW 6 92905306 unclassified probably benign
R0067:Adamts9 UTSW 6 92890167 missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92943085 missense probably benign
R0326:Adamts9 UTSW 6 92858057 nonsense probably null
R0396:Adamts9 UTSW 6 92798005 missense probably benign 0.00
R0490:Adamts9 UTSW 6 92872866 missense probably benign
R0504:Adamts9 UTSW 6 92912645 missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92858113 missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92880957 missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92903802 missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92796433 missense probably benign
R1433:Adamts9 UTSW 6 92849290 critical splice donor site probably null
R1558:Adamts9 UTSW 6 92908711 missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92880623 missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92863376 missense probably benign 0.27
R1855:Adamts9 UTSW 6 92901369 splice site probably benign
R1887:Adamts9 UTSW 6 92872788 critical splice donor site probably null
R1934:Adamts9 UTSW 6 92943121 missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92859849 missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92796394 missense probably benign
R2370:Adamts9 UTSW 6 92860203 missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92912831 missense probably benign
R2432:Adamts9 UTSW 6 92857900 missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92795910 splice site probably benign
R3015:Adamts9 UTSW 6 92872932 missense probably benign 0.05
R3611:Adamts9 UTSW 6 92869984 missense probably benign 0.05
R4024:Adamts9 UTSW 6 92872784 splice site probably benign
R4292:Adamts9 UTSW 6 92795996 missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92859864 missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92879959 nonsense probably null
R4677:Adamts9 UTSW 6 92816606 start codon destroyed probably null
R5114:Adamts9 UTSW 6 92890273 missense probably benign 0.03
R5260:Adamts9 UTSW 6 92807137 missense probably benign 0.00
R5423:Adamts9 UTSW 6 92880697 missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92854365 missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92798133 missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92903786 missense probably benign 0.02
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92908546 missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92859926 missense possibly damaging 0.83
R6051:Adamts9 UTSW 6 92890118 missense probably damaging 1.00
R6082:Adamts9 UTSW 6 92889949 missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92797021 missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92890120 missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92872335 missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92905191 missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92863354 missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92909793 nonsense probably null
R7095:Adamts9 UTSW 6 92887691 missense probably benign 0.39
R7287:Adamts9 UTSW 6 92890003 missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92894289 missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92858121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAACCTTGGCAACTTGC -3'
(R):5'- GTGGGAAATCTCTGACACATCC -3'

Sequencing Primer
(F):5'- CAGTTTCCTTGGATGAAGCAAG -3'
(R):5'- GGAAATCTCTGACACATCCCCTCTC -3'
Posted On2016-08-04