Incidental Mutation 'R5384:Dchs1'
ID 424935
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms C130033F22Rik, 3110041P15Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5384 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 105402197-105436861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 105407236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 2119 (V2119G)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078482]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000078482
AA Change: V2119G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: V2119G

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131504
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 125 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik T C 13: 119,606,496 (GRCm39) V246A probably benign Het
Abcc10 T C 17: 46,615,361 (GRCm39) S1343G possibly damaging Het
Abcd3 C A 3: 121,555,059 (GRCm39) probably null Het
Actl6a T A 3: 32,774,642 (GRCm39) M335K probably damaging Het
Adamts9 A C 6: 92,774,999 (GRCm39) C1090W probably damaging Het
Ajuba T C 14: 54,807,855 (GRCm39) Y459C probably damaging Het
Aldh7a1 T A 18: 56,667,325 (GRCm39) N316Y possibly damaging Het
Ankhd1 A G 18: 36,724,548 (GRCm39) E402G probably damaging Het
Ankrd36 A G 11: 5,639,340 (GRCm39) probably benign Het
Apeh A T 9: 107,963,662 (GRCm39) L551H probably damaging Het
Avpr1a T A 10: 122,285,274 (GRCm39) F189I probably damaging Het
BC034090 T A 1: 155,117,773 (GRCm39) H115L possibly damaging Het
C4b A T 17: 34,956,635 (GRCm39) D654E possibly damaging Het
Carns1 T A 19: 4,221,900 (GRCm39) probably null Het
Ccdc146 T A 5: 21,513,711 (GRCm39) E469V probably benign Het
Cdc27 A G 11: 104,397,966 (GRCm39) I804T probably benign Het
Cdh23 G A 10: 60,173,541 (GRCm39) T1651I probably damaging Het
Cenpo G A 12: 4,266,646 (GRCm39) P154L probably damaging Het
Cenpu G A 8: 47,015,534 (GRCm39) G150R probably benign Het
Chrna10 C A 7: 101,763,560 (GRCm39) L78F probably damaging Het
Chrne A T 11: 70,505,913 (GRCm39) N457K possibly damaging Het
Cidea A T 18: 67,493,236 (GRCm39) D85V probably damaging Het
Cldn18 T C 9: 99,591,911 (GRCm39) S31G possibly damaging Het
Clpb T A 7: 101,428,548 (GRCm39) I436N probably damaging Het
Col11a2 T C 17: 34,278,148 (GRCm39) probably null Het
Cul7 T C 17: 46,965,403 (GRCm39) V527A probably benign Het
Dcstamp A C 15: 39,622,715 (GRCm39) Q345H probably damaging Het
Dlgap3 A G 4: 127,130,123 (GRCm39) I955V probably damaging Het
Dvl1 A G 4: 155,938,143 (GRCm39) D97G probably damaging Het
Dync2h1 T C 9: 7,016,791 (GRCm39) D3573G probably damaging Het
Efr3b G T 12: 4,033,419 (GRCm39) F129L probably benign Het
Etaa1 G A 11: 17,897,539 (GRCm39) L193F probably damaging Het
Fam13c G A 10: 70,388,899 (GRCm39) S474N probably benign Het
Fam171a2 C A 11: 102,328,693 (GRCm39) V689L possibly damaging Het
Fastkd3 T C 13: 68,732,704 (GRCm39) F342L probably benign Het
Fat4 T C 3: 39,050,095 (GRCm39) S3986P possibly damaging Het
Fbxo38 A G 18: 62,674,042 (GRCm39) M13T probably benign Het
Fbxo48 G T 11: 16,904,329 (GRCm39) L160F possibly damaging Het
Fgr G A 4: 132,713,664 (GRCm39) probably null Het
Gbx2 T C 1: 89,856,635 (GRCm39) T252A probably damaging Het
Gm20671 A G 5: 32,977,286 (GRCm39) S1823P probably damaging Het
Gpatch8 A T 11: 102,399,053 (GRCm39) probably null Het
Gsdma A T 11: 98,557,275 (GRCm39) probably null Het
Gucy2g G A 19: 55,203,548 (GRCm39) A750V probably damaging Het
Hdac9 A G 12: 34,479,557 (GRCm39) Y223H probably damaging Het
Igsf5 C A 16: 96,192,226 (GRCm39) T275N probably benign Het
Il23r G A 6: 67,463,275 (GRCm39) H73Y probably benign Het
Ipo4 G T 14: 55,863,653 (GRCm39) R1026S probably benign Het
Jade1 T A 3: 41,546,137 (GRCm39) I54N probably damaging Het
Khdrbs1 G T 4: 129,635,729 (GRCm39) D75E possibly damaging Het
Lrwd1 A T 5: 136,152,728 (GRCm39) D511E possibly damaging Het
Ly75 A T 2: 60,164,831 (GRCm39) C782* probably null Het
Mmp3 C T 9: 7,451,759 (GRCm39) R366* probably null Het
Mrgpra6 A G 7: 46,838,629 (GRCm39) C190R probably damaging Het
Mtcl3 A G 10: 29,072,766 (GRCm39) D686G probably benign Het
Myh10 T A 11: 68,692,434 (GRCm39) L1369Q probably damaging Het
Myof C T 19: 37,941,435 (GRCm39) A792T probably damaging Het
Ncf1 A G 5: 134,250,659 (GRCm39) L373P probably damaging Het
Ncoa7 C A 10: 30,598,813 (GRCm39) A37S probably benign Het
Nfkb1 A G 3: 135,318,303 (GRCm39) V310A possibly damaging Het
Nmur2 T A 11: 55,931,040 (GRCm39) I224F probably damaging Het
Nr1d2 A T 14: 18,211,922 (GRCm38) S394T probably benign Het
Nudt12 A G 17: 59,310,434 (GRCm39) W390R probably damaging Het
Or11g24 T A 14: 50,662,846 (GRCm39) V290E possibly damaging Het
Or2m13 A G 16: 19,226,547 (GRCm39) L73P probably damaging Het
Or4a79 T A 2: 89,551,649 (GRCm39) I269F possibly damaging Het
Or4e1 T A 14: 52,700,714 (GRCm39) T251S probably benign Het
Or52a20 T C 7: 103,366,562 (GRCm39) F254L probably benign Het
Pate2 A G 9: 35,581,837 (GRCm39) M44V probably damaging Het
Pikfyve T C 1: 65,283,568 (GRCm39) L735S probably damaging Het
Plce1 C A 19: 38,748,535 (GRCm39) N1755K probably damaging Het
Pld1 C A 3: 28,079,469 (GRCm39) R90S probably damaging Het
Pnpla7 C A 2: 24,931,031 (GRCm39) P882Q probably damaging Het
Pold2 A G 11: 5,826,760 (GRCm39) L58P probably damaging Het
Ppm1d A G 11: 85,202,609 (GRCm39) E104G probably damaging Het
Ppm1e A T 11: 87,249,377 (GRCm39) L118Q possibly damaging Het
Ppp1r42 A G 1: 10,069,660 (GRCm39) L134P probably damaging Het
Prpf8 A G 11: 75,386,625 (GRCm39) D1038G probably damaging Het
Prss36 C A 7: 127,535,871 (GRCm39) R288L probably damaging Het
Prss51 T A 14: 64,334,543 (GRCm39) V108E probably damaging Het
Psma3 G T 12: 71,021,539 (GRCm39) G7W probably damaging Het
Psmc3ip A T 11: 100,983,430 (GRCm39) probably null Het
Qser1 T C 2: 104,616,987 (GRCm39) E1275G probably damaging Het
Rai2 A G X: 160,561,636 (GRCm39) N363S probably benign Het
Ranbp17 A T 11: 33,169,241 (GRCm39) V991D possibly damaging Het
Rcc2 A T 4: 140,447,877 (GRCm39) K468* probably null Het
S1pr2 T C 9: 20,878,890 (GRCm39) T313A probably benign Het
Sec1 C A 7: 45,328,264 (GRCm39) R261L probably benign Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Homo
Sgip1 G A 4: 102,791,763 (GRCm39) V362I possibly damaging Het
Shroom4 T A X: 6,497,523 (GRCm39) C894* probably null Het
Slc12a9 A T 5: 137,329,276 (GRCm39) L126Q probably damaging Het
Slx4 A G 16: 3,808,669 (GRCm39) S424P probably damaging Het
Smg5 T C 3: 88,258,600 (GRCm39) S524P probably damaging Het
Sncaip A G 18: 53,018,113 (GRCm39) D418G probably damaging Het
Spata31d1b C A 13: 59,866,032 (GRCm39) T1060K possibly damaging Het
Spink6 A G 18: 44,215,347 (GRCm39) T66A probably damaging Het
Sppl2c T A 11: 104,078,127 (GRCm39) I309K possibly damaging Het
Stk39 T A 2: 68,240,383 (GRCm39) D116V probably damaging Het
Supv3l1 A T 10: 62,266,375 (GRCm39) N600K possibly damaging Het
Svep1 T C 4: 58,104,545 (GRCm39) K1226R possibly damaging Het
Syne1 C T 10: 4,991,494 (GRCm39) V557I probably benign Het
Tas2r117 G T 6: 132,780,117 (GRCm39) S85I probably benign Het
Tcf20 T A 15: 82,740,400 (GRCm39) Q350H probably damaging Het
Tep1 A T 14: 51,105,774 (GRCm39) L82Q probably damaging Het
Tfb2m A C 1: 179,373,437 (GRCm39) probably null Het
Tm9sf1 C T 14: 55,880,301 (GRCm39) G32D possibly damaging Het
Tpd52 A T 3: 8,996,255 (GRCm39) probably null Het
Trappc8 A T 18: 20,966,119 (GRCm39) probably null Het
Trbv30 A G 6: 41,258,854 (GRCm39) T88A probably benign Het
Trim40 T A 17: 37,199,757 (GRCm39) N107I probably damaging Het
Trim80 A T 11: 115,338,843 (GRCm39) T558S probably benign Het
Ttn A G 2: 76,708,692 (GRCm39) probably benign Het
Vav3 A G 3: 109,434,791 (GRCm39) M441V possibly damaging Het
Vmn1r42 T A 6: 89,822,366 (GRCm39) I68F probably damaging Het
Vmn2r118 C T 17: 55,918,565 (GRCm39) G109D probably benign Het
Vmn2r5 T A 3: 64,416,931 (GRCm39) M76L probably benign Het
Vwa7 G T 17: 35,243,902 (GRCm39) probably null Het
Xndc1 T C 7: 101,731,395 (GRCm39) V378A probably benign Het
Zc3h12d A T 10: 7,729,014 (GRCm39) D126V probably damaging Het
Zc3h13 A G 14: 75,581,059 (GRCm39) N1682S probably benign Het
Zc3h15 T C 2: 83,490,574 (GRCm39) I236T possibly damaging Het
Zfp13 A T 17: 23,800,156 (GRCm39) I34N probably damaging Het
Zfp169 A T 13: 48,643,751 (GRCm39) C459S possibly damaging Het
Zfyve28 A G 5: 34,374,311 (GRCm39) C568R probably damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105,407,950 (GRCm39) missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105,407,236 (GRCm39) missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105,407,631 (GRCm39) missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105,404,468 (GRCm39) missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105,407,414 (GRCm39) missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105,407,150 (GRCm39) missense probably benign
IGL01292:Dchs1 APN 7 105,410,098 (GRCm39) missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105,411,418 (GRCm39) missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105,421,490 (GRCm39) missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105,421,134 (GRCm39) missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105,404,509 (GRCm39) missense probably benign 0.00
IGL01829:Dchs1 APN 7 105,404,604 (GRCm39) missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105,408,312 (GRCm39) missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105,406,798 (GRCm39) missense probably benign 0.00
IGL02012:Dchs1 APN 7 105,413,504 (GRCm39) missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105,414,094 (GRCm39) missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105,421,776 (GRCm39) missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105,404,395 (GRCm39) missense probably benign 0.22
IGL02430:Dchs1 APN 7 105,421,178 (GRCm39) missense probably benign 0.34
IGL02500:Dchs1 APN 7 105,405,013 (GRCm39) missense probably benign
IGL02741:Dchs1 APN 7 105,406,530 (GRCm39) missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105,405,698 (GRCm39) missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105,404,279 (GRCm39) missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105,407,612 (GRCm39) missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105,406,795 (GRCm39) missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105,408,178 (GRCm39) missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105,405,043 (GRCm39) missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105,405,139 (GRCm39) missense probably benign 0.18
R0091:Dchs1 UTSW 7 105,415,301 (GRCm39) splice site probably benign
R0193:Dchs1 UTSW 7 105,414,190 (GRCm39) missense probably benign 0.40
R0395:Dchs1 UTSW 7 105,407,745 (GRCm39) missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105,415,134 (GRCm39) missense probably benign 0.00
R0480:Dchs1 UTSW 7 105,420,696 (GRCm39) missense probably benign 0.14
R0485:Dchs1 UTSW 7 105,421,934 (GRCm39) missense probably benign 0.00
R0566:Dchs1 UTSW 7 105,408,402 (GRCm39) missense probably benign 0.00
R0571:Dchs1 UTSW 7 105,421,203 (GRCm39) missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105,407,985 (GRCm39) missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105,413,462 (GRCm39) missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105,412,656 (GRCm39) missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105,421,556 (GRCm39) missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105,414,191 (GRCm39) missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105,406,921 (GRCm39) missense probably benign
R1241:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105,404,778 (GRCm39) missense probably benign 0.40
R1427:Dchs1 UTSW 7 105,415,398 (GRCm39) missense probably benign 0.06
R1458:Dchs1 UTSW 7 105,404,451 (GRCm39) missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105,421,278 (GRCm39) nonsense probably null
R1524:Dchs1 UTSW 7 105,413,732 (GRCm39) missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105,408,138 (GRCm39) missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105,421,247 (GRCm39) missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105,421,068 (GRCm39) missense probably benign 0.01
R1577:Dchs1 UTSW 7 105,415,162 (GRCm39) missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105,411,977 (GRCm39) missense probably benign 0.24
R1676:Dchs1 UTSW 7 105,404,128 (GRCm39) missense probably benign 0.40
R1794:Dchs1 UTSW 7 105,420,927 (GRCm39) missense probably benign 0.02
R1826:Dchs1 UTSW 7 105,406,834 (GRCm39) missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105,413,363 (GRCm39) missense probably benign 0.00
R1924:Dchs1 UTSW 7 105,421,487 (GRCm39) missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105,415,109 (GRCm39) missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105,413,408 (GRCm39) missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105,421,605 (GRCm39) missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105,411,755 (GRCm39) missense probably benign 0.00
R2007:Dchs1 UTSW 7 105,404,532 (GRCm39) missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105,413,411 (GRCm39) missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105,403,301 (GRCm39) missense probably benign
R2474:Dchs1 UTSW 7 105,404,281 (GRCm39) missense probably benign 0.37
R2474:Dchs1 UTSW 7 105,422,045 (GRCm39) missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105,411,523 (GRCm39) missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105,406,292 (GRCm39) missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105,410,842 (GRCm39) missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105,411,770 (GRCm39) missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105,414,347 (GRCm39) missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105,415,397 (GRCm39) missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105,402,966 (GRCm39) missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105,404,059 (GRCm39) missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105,408,180 (GRCm39) missense probably benign
R4579:Dchs1 UTSW 7 105,403,972 (GRCm39) missense probably damaging 1.00
R4588:Dchs1 UTSW 7 105,405,248 (GRCm39) missense probably benign
R4613:Dchs1 UTSW 7 105,421,931 (GRCm39) missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105,403,562 (GRCm39) missense probably benign 0.02
R4696:Dchs1 UTSW 7 105,413,834 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,414,759 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4738:Dchs1 UTSW 7 105,407,880 (GRCm39) missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105,420,827 (GRCm39) missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105,415,133 (GRCm39) missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105,404,937 (GRCm39) missense probably benign 0.00
R4909:Dchs1 UTSW 7 105,415,462 (GRCm39) missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105,421,384 (GRCm39) missense probably benign 0.09
R5109:Dchs1 UTSW 7 105,414,221 (GRCm39) missense probably benign
R5126:Dchs1 UTSW 7 105,402,724 (GRCm39) missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105,404,865 (GRCm39) missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105,403,809 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,421,262 (GRCm39) missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105,404,500 (GRCm39) missense probably benign 0.11
R5623:Dchs1 UTSW 7 105,421,976 (GRCm39) missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105,422,016 (GRCm39) missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105,404,955 (GRCm39) missense probably benign 0.01
R5743:Dchs1 UTSW 7 105,420,803 (GRCm39) missense probably benign
R5759:Dchs1 UTSW 7 105,413,383 (GRCm39) missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105,422,247 (GRCm39) missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105,421,242 (GRCm39) missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105,408,373 (GRCm39) missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105,405,132 (GRCm39) missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105,403,302 (GRCm39) missense probably benign 0.08
R6065:Dchs1 UTSW 7 105,404,628 (GRCm39) missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105,410,132 (GRCm39) missense probably benign
R6137:Dchs1 UTSW 7 105,414,313 (GRCm39) missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105,414,145 (GRCm39) missense probably benign 0.05
R6363:Dchs1 UTSW 7 105,407,679 (GRCm39) missense probably benign 0.12
R6466:Dchs1 UTSW 7 105,413,748 (GRCm39) missense probably benign 0.09
R6544:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105,408,013 (GRCm39) missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105,412,120 (GRCm39) missense probably benign 0.17
R6632:Dchs1 UTSW 7 105,411,085 (GRCm39) missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105,406,210 (GRCm39) missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105,412,710 (GRCm39) missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105,406,228 (GRCm39) missense probably benign
R7064:Dchs1 UTSW 7 105,412,392 (GRCm39) missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105,411,078 (GRCm39) missense probably benign 0.04
R7191:Dchs1 UTSW 7 105,414,646 (GRCm39) missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105,404,338 (GRCm39) nonsense probably null
R7380:Dchs1 UTSW 7 105,407,835 (GRCm39) missense probably benign 0.35
R7438:Dchs1 UTSW 7 105,404,155 (GRCm39) missense probably benign 0.30
R7496:Dchs1 UTSW 7 105,411,066 (GRCm39) missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105,421,580 (GRCm39) missense probably benign 0.00
R7604:Dchs1 UTSW 7 105,415,189 (GRCm39) missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105,408,445 (GRCm39) missense probably benign
R7821:Dchs1 UTSW 7 105,414,352 (GRCm39) missense probably benign 0.00
R7834:Dchs1 UTSW 7 105,414,774 (GRCm39) missense probably benign 0.39
R7841:Dchs1 UTSW 7 105,412,180 (GRCm39) missense probably benign
R7913:Dchs1 UTSW 7 105,408,435 (GRCm39) missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105,404,395 (GRCm39) missense probably benign 0.45
R8076:Dchs1 UTSW 7 105,411,189 (GRCm39) missense probably damaging 1.00
R8076:Dchs1 UTSW 7 105,405,128 (GRCm39) missense possibly damaging 0.52
R8087:Dchs1 UTSW 7 105,402,706 (GRCm39) missense probably benign 0.41
R8125:Dchs1 UTSW 7 105,414,089 (GRCm39) missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105,411,824 (GRCm39) missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105,414,718 (GRCm39) missense probably benign 0.22
R8476:Dchs1 UTSW 7 105,408,015 (GRCm39) missense probably benign 0.05
R8497:Dchs1 UTSW 7 105,408,168 (GRCm39) missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105,420,945 (GRCm39) missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105,410,064 (GRCm39) missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105,404,597 (GRCm39) missense probably benign 0.00
R8948:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R8950:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R9029:Dchs1 UTSW 7 105,402,919 (GRCm39) missense probably benign 0.13
R9039:Dchs1 UTSW 7 105,405,215 (GRCm39) missense probably benign 0.11
R9081:Dchs1 UTSW 7 105,403,636 (GRCm39) missense probably benign 0.00
R9134:Dchs1 UTSW 7 105,404,910 (GRCm39) missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105,415,126 (GRCm39) missense probably benign
R9162:Dchs1 UTSW 7 105,414,732 (GRCm39) missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105,422,114 (GRCm39) missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105,404,833 (GRCm39) missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105,403,120 (GRCm39) missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105,415,402 (GRCm39) missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105,414,981 (GRCm39) critical splice donor site probably null
R9392:Dchs1 UTSW 7 105,421,869 (GRCm39) missense probably benign 0.09
R9619:Dchs1 UTSW 7 105,413,662 (GRCm39) missense probably benign 0.07
R9680:Dchs1 UTSW 7 105,411,625 (GRCm39) missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105,407,191 (GRCm39) missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105,412,682 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,406,900 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,407,758 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGAAGATTGCTGACCCTGGC -3'
(R):5'- AGCATTCTCAGTGGGAATGAG -3'

Sequencing Primer
(F):5'- TTGGCCACAAGTAAGCCTG -3'
(R):5'- TGGGAATGAGAGAGGGATATTCTCC -3'
Posted On 2016-08-04