Mutagenetix > Incidental Mutation

Incidental Mutation 'R5384:Dchs1'

424936

Institutional Source

Beutler Lab

Gene Symbol

Dchs1

Ensembl Gene

ENSMUSG00000036862

Gene Name

dachsous cadherin related 1

Synonyms

3110041P15Rik, C130033F22Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5384 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105752990-105787654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 105772055 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 386 (D386V)

Ref Sequence

ENSEMBL: ENSMUSP00000077574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078482]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000078482
AA Change: D386V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: D386V

Domain	Start	End	E-Value	Type
signal peptide	1	36	N/A	INTRINSIC
CA	58	135	5.2e-11	SMART
CA	159	247	6.1e-17	SMART
CA	271	354	2.6e-30	SMART
CA	382	464	7.8e-26	SMART
CA	489	570	1.2e-34	SMART
CA	594	677	1.9e-27	SMART
CA	701	782	5.3e-11	SMART
CA	806	886	1e-12	SMART
CA	910	990	3.3e-14	SMART
CA	1016	1097	3.6e-18	SMART
CA	1121	1203	3.1e-34	SMART
CA	1233	1307	8.8e-16	SMART
low complexity region	1323	1335	N/A	INTRINSIC
CA	1344	1427	9.9e-9	SMART
CA	1451	1537	1.5e-23	SMART
CA	1560	1640	7.2e-32	SMART
CA	1664	1742	1.8e-31	SMART
CA	1765	1846	7.8e-30	SMART
CA	1870	1951	3.7e-26	SMART
low complexity region	1957	1965	N/A	INTRINSIC
CA	1979	2059	1.1e-6	SMART
CA	2083	2162	2.7e-18	SMART
CA	2186	2268	2.2e-26	SMART
CA	2291	2367	1e-18	SMART
CA	2391	2473	1.8e-23	SMART
CA	2497	2593	3.5e-21	SMART
CA	2617	2697	1.2e-25	SMART
CA	2721	2804	1.9e-18	SMART
CA	2828	2919	3e-3	SMART
transmembrane domain	2932	2954	N/A	INTRINSIC
low complexity region	3001	3017	N/A	INTRINSIC
low complexity region	3046	3055	N/A	INTRINSIC
low complexity region	3088	3097	N/A	INTRINSIC
low complexity region	3185	3196	N/A	INTRINSIC
low complexity region	3237	3259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154659

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 125 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	C	13: 119,469,960	V246A	probably benign	Het
Abcc10	T	C	17: 46,304,435	S1343G	possibly damaging	Het
Abcd3	C	A	3: 121,761,410		probably null	Het
Actl6a	T	A	3: 32,720,493	M335K	probably damaging	Het
Adamts9	A	C	6: 92,798,018	C1090W	probably damaging	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Aldh7a1	T	A	18: 56,534,253	N316Y	possibly damaging	Het
Ankhd1	A	G	18: 36,591,495	E402G	probably damaging	Het
Ankrd36	A	G	11: 5,689,340		probably benign	Het
Apeh	A	T	9: 108,086,463	L551H	probably damaging	Het
Avpr1a	T	A	10: 122,449,369	F189I	probably damaging	Het
BC034090	T	A	1: 155,242,027	H115L	possibly damaging	Het
C4b	A	T	17: 34,737,661	D654E	possibly damaging	Het
Carns1	T	A	19: 4,171,901		probably null	Het
Ccdc146	T	A	5: 21,308,713	E469V	probably benign	Het
Cdc27	A	G	11: 104,507,140	I804T	probably benign	Het
Cdh23	G	A	10: 60,337,762	T1651I	probably damaging	Het
Cenpo	G	A	12: 4,216,646	P154L	probably damaging	Het
Cenpu	G	A	8: 46,562,499	G150R	probably benign	Het
Chrna10	C	A	7: 102,114,353	L78F	probably damaging	Het
Chrne	A	T	11: 70,615,087	N457K	possibly damaging	Het
Cidea	A	T	18: 67,360,166	D85V	probably damaging	Het
Cldn18	T	C	9: 99,709,858	S31G	possibly damaging	Het
Clpb	T	A	7: 101,779,341	I436N	probably damaging	Het
Col11a2	T	C	17: 34,059,174		probably null	Het
Cul7	T	C	17: 46,654,477	V527A	probably benign	Het
Dcstamp	A	C	15: 39,759,319	Q345H	probably damaging	Het
Dlgap3	A	G	4: 127,236,330	I955V	probably damaging	Het
Dvl1	A	G	4: 155,853,686	D97G	probably damaging	Het
Dync2h1	T	C	9: 7,016,791	D3573G	probably damaging	Het
Efr3b	G	T	12: 3,983,419	F129L	probably benign	Het
Etaa1	G	A	11: 17,947,539	L193F	probably damaging	Het
Fam13c	G	A	10: 70,553,069	S474N	probably benign	Het
Fam171a2	C	A	11: 102,437,867	V689L	possibly damaging	Het
Fastkd3	T	C	13: 68,584,585	F342L	probably benign	Het
Fat4	T	C	3: 38,995,946	S3986P	possibly damaging	Het
Fbxo38	A	G	18: 62,540,971	M13T	probably benign	Het
Fbxo48	G	T	11: 16,954,329	L160F	possibly damaging	Het
Fgr	G	A	4: 132,986,353		probably null	Het
Gbx2	T	C	1: 89,928,913	T252A	probably damaging	Het
Gm20671	A	G	5: 32,819,942	S1823P	probably damaging	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gsdma	A	T	11: 98,666,449		probably null	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hdac9	A	G	12: 34,429,558	Y223H	probably damaging	Het
Igsf5	C	A	16: 96,391,026	T275N	probably benign	Het
Il23r	G	A	6: 67,486,291	H73Y	probably benign	Het
Ipo4	G	T	14: 55,626,196	R1026S	probably benign	Het
Jade1	T	A	3: 41,591,702	I54N	probably damaging	Het
Khdrbs1	G	T	4: 129,741,936	D75E	possibly damaging	Het
Lrwd1	A	T	5: 136,123,874	D511E	possibly damaging	Het
Ly75	A	T	2: 60,334,487	C782*	probably null	Het
Mmp3	C	T	9: 7,451,759	R366*	probably null	Het
Mrgpra6	A	G	7: 47,188,881	C190R	probably damaging	Het
Myh10	T	A	11: 68,801,608	L1369Q	probably damaging	Het
Myof	C	T	19: 37,952,987	A792T	probably damaging	Het
Ncf1	A	G	5: 134,221,805	L373P	probably damaging	Het
Ncoa7	C	A	10: 30,722,817	A37S	probably benign	Het
Nfkb1	A	G	3: 135,612,542	V310A	possibly damaging	Het
Nmur2	T	A	11: 56,040,214	I224F	probably damaging	Het
Nr1d2	A	T	14: 18,211,922	S394T	probably benign	Het
Nudt12	A	G	17: 59,003,439	W390R	probably damaging	Het
Olfr1252	T	A	2: 89,721,305	I269F	possibly damaging	Het
Olfr1508	T	A	14: 52,463,257	T251S	probably benign	Het
Olfr165	A	G	16: 19,407,797	L73P	probably damaging	Het
Olfr243	T	C	7: 103,717,355	F254L	probably benign	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Pate2	A	G	9: 35,670,541	M44V	probably damaging	Het
Pikfyve	T	C	1: 65,244,409	L735S	probably damaging	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pld1	C	A	3: 28,025,320	R90S	probably damaging	Het
Pnpla7	C	A	2: 25,041,019	P882Q	probably damaging	Het
Pold2	A	G	11: 5,876,760	L58P	probably damaging	Het
Ppm1d	A	G	11: 85,311,783	E104G	probably damaging	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Ppp1r42	A	G	1: 9,999,435	L134P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Prss36	C	A	7: 127,936,699	R288L	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Psma3	G	T	12: 70,974,765	G7W	probably damaging	Het
Psmc3ip	A	T	11: 101,092,604		probably null	Het
Qser1	T	C	2: 104,786,642	E1275G	probably damaging	Het
Rai2	A	G	X: 161,778,640	N363S	probably benign	Het
Ranbp17	A	T	11: 33,219,241	V991D	possibly damaging	Het
Rcc2	A	T	4: 140,720,566	K468*	probably null	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Sec1	C	A	7: 45,678,840	R261L	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Homo
Sgip1	G	A	4: 102,934,566	V362I	possibly damaging	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc12a9	A	T	5: 137,331,014	L126Q	probably damaging	Het
Slx4	A	G	16: 3,990,805	S424P	probably damaging	Het
Smg5	T	C	3: 88,351,293	S524P	probably damaging	Het
Sncaip	A	G	18: 52,885,041	D418G	probably damaging	Het
Soga3	A	G	10: 29,196,770	D686G	probably benign	Het
Spata31d1b	C	A	13: 59,718,218	T1060K	possibly damaging	Het
Spink6	A	G	18: 44,082,280	T66A	probably damaging	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stk39	T	A	2: 68,410,039	D116V	probably damaging	Het
Supv3l1	A	T	10: 62,430,596	N600K	possibly damaging	Het
Svep1	T	C	4: 58,104,545	K1226R	possibly damaging	Het
Syne1	C	T	10: 5,041,494	V557I	probably benign	Het
Tas2r117	G	T	6: 132,803,154	S85I	probably benign	Het
Tcf20	T	A	15: 82,856,199	Q350H	probably damaging	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tfb2m	A	C	1: 179,545,872		probably null	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tpd52	A	T	3: 8,931,195		probably null	Het
Trappc8	A	T	18: 20,833,062		probably null	Het
Trbv30	A	G	6: 41,281,920	T88A	probably benign	Het
Trim40	T	A	17: 36,888,865	N107I	probably damaging	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Ttn	A	G	2: 76,878,348		probably benign	Het
Vav3	A	G	3: 109,527,475	M441V	possibly damaging	Het
Vmn1r42	T	A	6: 89,845,384	I68F	probably damaging	Het
Vmn2r118	C	T	17: 55,611,565	G109D	probably benign	Het
Vmn2r5	T	A	3: 64,509,510	M76L	probably benign	Het
Vwa7	G	T	17: 35,024,926		probably null	Het
Xndc1	T	C	7: 102,082,188	V378A	probably benign	Het
Zc3h12d	A	T	10: 7,853,250	D126V	probably damaging	Het
Zc3h13	A	G	14: 75,343,619	N1682S	probably benign	Het
Zc3h15	T	C	2: 83,660,230	I236T	possibly damaging	Het
Zfp13	A	T	17: 23,581,182	I34N	probably damaging	Het
Zfp169	A	T	13: 48,490,275	C459S	possibly damaging	Het
Zfyve28	A	G	5: 34,216,967	C568R	probably damaging	Het

Other mutations in Dchs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Dchs1	APN	7	105758743	missense	probably damaging	1.00
IGL00422:Dchs1	APN	7	105758029	missense	possibly damaging	0.88
IGL00427:Dchs1	APN	7	105758424	missense	probably damaging	0.98
IGL00469:Dchs1	APN	7	105755261	missense	probably damaging	1.00
IGL00470:Dchs1	APN	7	105758207	missense	probably damaging	1.00
IGL00534:Dchs1	APN	7	105757943	missense	probably benign
IGL01292:Dchs1	APN	7	105760891	missense	probably damaging	0.98
IGL01380:Dchs1	APN	7	105762211	missense	probably damaging	1.00
IGL01396:Dchs1	APN	7	105772283	missense	probably damaging	1.00
IGL01448:Dchs1	APN	7	105771927	missense	probably damaging	0.98
IGL01759:Dchs1	APN	7	105755302	missense	probably benign	0.00
IGL01829:Dchs1	APN	7	105755397	missense	probably damaging	0.99
IGL01946:Dchs1	APN	7	105759105	missense	probably damaging	1.00
IGL01955:Dchs1	APN	7	105757591	missense	probably benign	0.00
IGL02012:Dchs1	APN	7	105764297	missense	probably damaging	0.98
IGL02222:Dchs1	APN	7	105764887	missense	probably damaging	1.00
IGL02261:Dchs1	APN	7	105772569	missense	probably damaging	1.00
IGL02365:Dchs1	APN	7	105755188	missense	probably benign	0.22
IGL02430:Dchs1	APN	7	105771971	missense	probably benign	0.34
IGL02500:Dchs1	APN	7	105755806	missense	probably benign
IGL02741:Dchs1	APN	7	105757323	missense	probably damaging	1.00
IGL02890:Dchs1	APN	7	105756491	missense	probably damaging	1.00
IGL03213:Dchs1	APN	7	105755072	missense	probably damaging	1.00
G1patch:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
P0026:Dchs1	UTSW	7	105758405	missense	probably damaging	0.99
PIT4377001:Dchs1	UTSW	7	105757588	missense	probably damaging	1.00
PIT4791001:Dchs1	UTSW	7	105758971	missense	probably damaging	1.00
R0013:Dchs1	UTSW	7	105755836	missense	possibly damaging	0.90
R0090:Dchs1	UTSW	7	105755932	missense	probably benign	0.18
R0091:Dchs1	UTSW	7	105766094	splice site	probably benign
R0193:Dchs1	UTSW	7	105764983	missense	probably benign	0.40
R0395:Dchs1	UTSW	7	105758538	missense	probably damaging	1.00
R0448:Dchs1	UTSW	7	105765927	missense	probably benign	0.00
R0480:Dchs1	UTSW	7	105771489	missense	probably benign	0.14
R0485:Dchs1	UTSW	7	105772727	missense	probably benign	0.00
R0566:Dchs1	UTSW	7	105759195	missense	probably benign	0.00
R0571:Dchs1	UTSW	7	105771996	missense	probably damaging	1.00
R0573:Dchs1	UTSW	7	105758778	missense	probably damaging	0.98
R0577:Dchs1	UTSW	7	105764255	missense	possibly damaging	0.78
R0622:Dchs1	UTSW	7	105763449	missense	probably damaging	1.00
R0654:Dchs1	UTSW	7	105772349	missense	probably damaging	1.00
R0677:Dchs1	UTSW	7	105764984	missense	probably damaging	1.00
R1171:Dchs1	UTSW	7	105757714	missense	probably benign
R1241:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R1389:Dchs1	UTSW	7	105755571	missense	probably benign	0.40
R1427:Dchs1	UTSW	7	105766191	missense	probably benign	0.06
R1458:Dchs1	UTSW	7	105755244	missense	probably damaging	1.00
R1513:Dchs1	UTSW	7	105772071	nonsense	probably null
R1524:Dchs1	UTSW	7	105764525	missense	probably damaging	1.00
R1525:Dchs1	UTSW	7	105758931	missense	probably damaging	1.00
R1534:Dchs1	UTSW	7	105772040	missense	probably damaging	0.98
R1567:Dchs1	UTSW	7	105771861	missense	probably benign	0.01
R1577:Dchs1	UTSW	7	105765955	missense	probably damaging	1.00
R1603:Dchs1	UTSW	7	105762770	missense	probably benign	0.24
R1676:Dchs1	UTSW	7	105754921	missense	probably benign	0.40
R1794:Dchs1	UTSW	7	105771720	missense	probably benign	0.02
R1826:Dchs1	UTSW	7	105757627	missense	probably damaging	1.00
R1892:Dchs1	UTSW	7	105764156	missense	probably benign	0.00
R1924:Dchs1	UTSW	7	105772280	missense	possibly damaging	0.81
R1932:Dchs1	UTSW	7	105765902	missense	probably damaging	1.00
R1962:Dchs1	UTSW	7	105764201	missense	probably damaging	1.00
R1985:Dchs1	UTSW	7	105772398	missense	possibly damaging	0.72
R1993:Dchs1	UTSW	7	105762548	missense	probably benign	0.00
R2007:Dchs1	UTSW	7	105755325	missense	probably damaging	1.00
R2316:Dchs1	UTSW	7	105764204	missense	possibly damaging	0.71
R2351:Dchs1	UTSW	7	105754094	missense	probably benign
R2474:Dchs1	UTSW	7	105755074	missense	probably benign	0.37
R2474:Dchs1	UTSW	7	105772838	missense	probably damaging	1.00
R3429:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3430:Dchs1	UTSW	7	105756504	missense	possibly damaging	0.85
R3737:Dchs1	UTSW	7	105762316	missense	possibly damaging	0.88
R3767:Dchs1	UTSW	7	105757085	missense	possibly damaging	0.67
R3874:Dchs1	UTSW	7	105761635	missense	probably damaging	1.00
R3883:Dchs1	UTSW	7	105762563	missense	probably damaging	1.00
R4105:Dchs1	UTSW	7	105765140	missense	probably damaging	1.00
R4209:Dchs1	UTSW	7	105766190	missense	probably damaging	0.99
R4329:Dchs1	UTSW	7	105753759	missense	probably damaging	1.00
R4516:Dchs1	UTSW	7	105754852	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105754765	missense	probably damaging	1.00
R4579:Dchs1	UTSW	7	105758973	missense	probably benign
R4588:Dchs1	UTSW	7	105756041	missense	probably benign
R4613:Dchs1	UTSW	7	105772724	missense	probably damaging	1.00
R4632:Dchs1	UTSW	7	105754355	missense	probably benign	0.02
R4696:Dchs1	UTSW	7	105764627	missense	probably damaging	1.00
R4725:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4725:Dchs1	UTSW	7	105765552	missense	probably damaging	1.00
R4738:Dchs1	UTSW	7	105758673	missense	probably damaging	0.96
R4768:Dchs1	UTSW	7	105771620	missense	possibly damaging	0.96
R4784:Dchs1	UTSW	7	105765926	missense	probably damaging	1.00
R4864:Dchs1	UTSW	7	105755253	missense	probably damaging	0.98
R4880:Dchs1	UTSW	7	105755730	missense	probably benign	0.00
R4909:Dchs1	UTSW	7	105766255	missense	probably damaging	1.00
R5102:Dchs1	UTSW	7	105772177	missense	probably benign	0.09
R5109:Dchs1	UTSW	7	105765014	missense	probably benign
R5126:Dchs1	UTSW	7	105753517	missense	probably damaging	1.00
R5149:Dchs1	UTSW	7	105755658	missense	probably damaging	0.98
R5330:Dchs1	UTSW	7	105754602	missense	probably damaging	1.00
R5384:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5386:Dchs1	UTSW	7	105758029	missense	probably damaging	1.00
R5622:Dchs1	UTSW	7	105755293	missense	probably benign	0.11
R5623:Dchs1	UTSW	7	105772769	missense	probably damaging	1.00
R5708:Dchs1	UTSW	7	105772809	missense	probably damaging	1.00
R5718:Dchs1	UTSW	7	105755748	missense	probably benign	0.01
R5743:Dchs1	UTSW	7	105771596	missense	probably benign
R5759:Dchs1	UTSW	7	105764176	missense	probably damaging	0.99
R5772:Dchs1	UTSW	7	105773040	missense	probably damaging	1.00
R5860:Dchs1	UTSW	7	105772035	missense	probably damaging	1.00
R5916:Dchs1	UTSW	7	105759166	missense	probably damaging	1.00
R5965:Dchs1	UTSW	7	105755925	missense	probably damaging	1.00
R5997:Dchs1	UTSW	7	105754095	missense	probably benign	0.08
R6065:Dchs1	UTSW	7	105755421	missense	probably damaging	1.00
R6136:Dchs1	UTSW	7	105760925	missense	probably benign
R6137:Dchs1	UTSW	7	105765106	missense	probably damaging	0.99
R6324:Dchs1	UTSW	7	105764938	missense	probably benign	0.05
R6363:Dchs1	UTSW	7	105758472	missense	probably benign	0.12
R6466:Dchs1	UTSW	7	105764541	missense	probably benign	0.09
R6544:Dchs1	UTSW	7	105758178	missense	probably damaging	1.00
R6572:Dchs1	UTSW	7	105758806	missense	possibly damaging	0.94
R6579:Dchs1	UTSW	7	105762913	missense	probably benign	0.17
R6632:Dchs1	UTSW	7	105761878	missense	probably damaging	1.00
R6725:Dchs1	UTSW	7	105758793	missense	probably damaging	0.99
R6789:Dchs1	UTSW	7	105757003	missense	possibly damaging	0.61
R6868:Dchs1	UTSW	7	105763503	missense	possibly damaging	0.91
R7058:Dchs1	UTSW	7	105757021	missense	probably benign
R7064:Dchs1	UTSW	7	105763185	missense	probably damaging	0.99
R7076:Dchs1	UTSW	7	105761871	missense	probably benign	0.04
R7191:Dchs1	UTSW	7	105765439	missense	possibly damaging	0.89
R7298:Dchs1	UTSW	7	105755131	nonsense	probably null
R7380:Dchs1	UTSW	7	105758628	missense	probably benign	0.35
R7438:Dchs1	UTSW	7	105754948	missense	probably benign	0.30
R7496:Dchs1	UTSW	7	105761859	missense	probably damaging	1.00
R7534:Dchs1	UTSW	7	105772373	missense	probably benign	0.00
R7604:Dchs1	UTSW	7	105765982	missense	probably damaging	1.00
R7631:Dchs1	UTSW	7	105759238	missense	probably benign
R7821:Dchs1	UTSW	7	105765145	missense	probably benign	0.00
R7834:Dchs1	UTSW	7	105765567	missense	probably benign	0.39
R7841:Dchs1	UTSW	7	105762973	missense	probably benign
R7913:Dchs1	UTSW	7	105759228	missense	possibly damaging	0.61
R8041:Dchs1	UTSW	7	105755188	missense	probably benign	0.45
R8076:Dchs1	UTSW	7	105755921	missense	possibly damaging	0.52
R8076:Dchs1	UTSW	7	105761982	missense	probably damaging	1.00
R8087:Dchs1	UTSW	7	105753499	missense	probably benign	0.41
R8125:Dchs1	UTSW	7	105764882	missense	possibly damaging	0.91
R8223:Dchs1	UTSW	7	105762617	missense	possibly damaging	0.81
R8239:Dchs1	UTSW	7	105765511	missense	probably benign	0.22
R8476:Dchs1	UTSW	7	105758808	missense	probably benign	0.05
R8497:Dchs1	UTSW	7	105758961	missense	probably damaging	1.00
R8770:Dchs1	UTSW	7	105771738	missense	probably damaging	1.00
R8856:Dchs1	UTSW	7	105760857	missense	probably damaging	1.00
R8866:Dchs1	UTSW	7	105755390	missense	probably benign	0.00
R8948:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R8950:Dchs1	UTSW	7	105759005	missense	probably benign	0.30
R9029:Dchs1	UTSW	7	105753712	missense	probably benign	0.13
R9039:Dchs1	UTSW	7	105756008	missense	probably benign	0.11
R9081:Dchs1	UTSW	7	105754429	missense	probably benign	0.00
R9134:Dchs1	UTSW	7	105755703	missense	probably damaging	0.96
R9159:Dchs1	UTSW	7	105765919	missense	probably benign
R9162:Dchs1	UTSW	7	105765525	missense	probably damaging	1.00
R9169:Dchs1	UTSW	7	105772907	missense	probably damaging	1.00
R9262:Dchs1	UTSW	7	105755626	missense	probably damaging	1.00
R9292:Dchs1	UTSW	7	105753913	missense	probably damaging	1.00
R9325:Dchs1	UTSW	7	105766195	missense	possibly damaging	0.51
R9376:Dchs1	UTSW	7	105765774	critical splice donor site	probably null
R9392:Dchs1	UTSW	7	105772662	missense	probably benign	0.09
R9619:Dchs1	UTSW	7	105764455	missense	probably benign	0.07
R9680:Dchs1	UTSW	7	105762418	missense	probably damaging	1.00
R9687:Dchs1	UTSW	7	105757984	missense	probably damaging	0.99
R9747:Dchs1	UTSW	7	105763475	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105757693	missense	probably damaging	1.00
Z1177:Dchs1	UTSW	7	105758551	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTAGCACAAAAGCAGCTTCG -3'
(R):5'- ATGAACTGGTGGTACAGGC -3'

Sequencing Primer
(F):5'- AAGCAGCTTCGGCCCTAAGTG -3'
(R):5'- TGGTACAGGCACGGGATG -3'

Posted On

2016-08-04