Incidental Mutation 'R0491:Psme1'
ID42496
Institutional Source Beutler Lab
Gene Symbol Psme1
Ensembl Gene ENSMUSG00000022216
Gene Nameproteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
SynonymsPA28a
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0491 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55578123-55581529 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 55579921 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022826] [ENSMUST00000022828] [ENSMUST00000089619] [ENSMUST00000172738] [ENSMUST00000174259] [ENSMUST00000174484] [ENSMUST00000174563]
Predicted Effect probably benign
Transcript: ENSMUST00000022826
SMART Domains Protein: ENSMUSP00000022826
Gene: ENSMUSG00000022215

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 95 114 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022828
SMART Domains Protein: ENSMUSP00000022828
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 3 191 1.9e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089619
SMART Domains Protein: ENSMUSP00000087046
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.1e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 236 2.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135068
Predicted Effect probably benign
Transcript: ENSMUST00000172738
SMART Domains Protein: ENSMUSP00000133867
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 3.8e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 129 226 3.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174148
Predicted Effect probably benign
Transcript: ENSMUST00000174259
SMART Domains Protein: ENSMUSP00000134735
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 8 68 6e-27 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 103 247 9.5e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174352
SMART Domains Protein: ENSMUSP00000133463
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 1 43 6.3e-11 PFAM
Pfam:UPF0172 41 82 1.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174419
Predicted Effect probably benign
Transcript: ENSMUST00000174484
SMART Domains Protein: ENSMUSP00000133883
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.4e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 238 7.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174563
SMART Domains Protein: ENSMUSP00000133366
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 58 7.5e-18 PFAM
low complexity region 59 87 N/A INTRINSIC
Pfam:PA28_beta 89 173 5.4e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174618
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228834
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Olfr1475 G A 19: 13,479,493 A235V probably damaging Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Psme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02532:Psme1 APN 14 55581138 nonsense probably null
IGL02867:Psme1 APN 14 55579926 splice site probably benign
IGL02889:Psme1 APN 14 55579926 splice site probably benign
IGL03257:Psme1 APN 14 55580629 missense probably damaging 1.00
R1078:Psme1 UTSW 14 55580650 missense probably damaging 1.00
R1597:Psme1 UTSW 14 55580765 missense probably damaging 1.00
R7620:Psme1 UTSW 14 55580340 nonsense probably null
R8050:Psme1 UTSW 14 55579599 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GCCCTTACATCACTGCCTTGGAAAG -3'
(R):5'- AAGCTCTGGGTCACCAGTGTCTTC -3'

Sequencing Primer
(F):5'- AAAGGGTGTTTGCTTCTGACC -3'
(R):5'- GTCACCAGTGTCTTCCCAGC -3'
Posted On2013-05-23