Mutagenetix > Incidental Mutation

Incidental Mutation 'R5384:C4b'

424998

Institutional Source

Beutler Lab

Gene Symbol

C4b

Ensembl Gene

ENSMUSG00000073418

Gene Name

complement component 4B (Chido blood group)

Synonyms

C4, Ss

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5384 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34728380-34743882 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 34737661 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 654 (D654E)

Ref Sequence

ENSEMBL: ENSMUSP00000069418 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069507]

AlphaFold

P01029

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069507
AA Change: D654E

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: D654E

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:A2M_N	138	231	2e-19	PFAM
A2M_N_2	470	609	2.87e-26	SMART
ANATO	700	734	3.58e-12	SMART
low complexity region	761	771	N/A	INTRINSIC
A2M	779	867	1.46e-27	SMART
Pfam:Thiol-ester_cl	995	1024	7.7e-13	PFAM
Pfam:A2M_comp	1047	1313	1.3e-82	PFAM
low complexity region	1441	1447	N/A	INTRINSIC
A2M_recep	1475	1564	1.03e-36	SMART
C345C	1608	1720	5.69e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173057

SMART Domains

Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

Domain	Start	End	E-Value	Type
Pfam:A2M	1	62	6.5e-20	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 126 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	T	C	13: 119,469,960	V246A	probably benign	Het
Abcc10	T	C	17: 46,304,435	S1343G	possibly damaging	Het
Abcd3	C	A	3: 121,761,410		probably null	Het
Actl6a	T	A	3: 32,720,493	M335K	probably damaging	Het
Adamts9	A	C	6: 92,798,018	C1090W	probably damaging	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Aldh7a1	T	A	18: 56,534,253	N316Y	possibly damaging	Het
Ankhd1	A	G	18: 36,591,495	E402G	probably damaging	Het
Ankrd36	A	G	11: 5,689,340		probably benign	Het
Apeh	A	T	9: 108,086,463	L551H	probably damaging	Het
Avpr1a	T	A	10: 122,449,369	F189I	probably damaging	Het
BC034090	T	A	1: 155,242,027	H115L	possibly damaging	Het
Carns1	T	A	19: 4,171,901		probably null	Het
Ccdc146	T	A	5: 21,308,713	E469V	probably benign	Het
Cdc27	A	G	11: 104,507,140	I804T	probably benign	Het
Cdh23	G	A	10: 60,337,762	T1651I	probably damaging	Het
Cenpo	G	A	12: 4,216,646	P154L	probably damaging	Het
Cenpu	G	A	8: 46,562,499	G150R	probably benign	Het
Chrna10	C	A	7: 102,114,353	L78F	probably damaging	Het
Chrne	A	T	11: 70,615,087	N457K	possibly damaging	Het
Cidea	A	T	18: 67,360,166	D85V	probably damaging	Het
Cldn18	T	C	9: 99,709,858	S31G	possibly damaging	Het
Clpb	T	A	7: 101,779,341	I436N	probably damaging	Het
Col11a2	T	C	17: 34,059,174		probably null	Het
Cul7	T	C	17: 46,654,477	V527A	probably benign	Het
Dchs1	A	C	7: 105,758,029	V2119G	probably damaging	Het
Dchs1	T	A	7: 105,772,055	D386V	probably damaging	Het
Dcstamp	A	C	15: 39,759,319	Q345H	probably damaging	Het
Dlgap3	A	G	4: 127,236,330	I955V	probably damaging	Het
Dvl1	A	G	4: 155,853,686	D97G	probably damaging	Het
Dync2h1	T	C	9: 7,016,791	D3573G	probably damaging	Het
Efr3b	G	T	12: 3,983,419	F129L	probably benign	Het
Etaa1	G	A	11: 17,947,539	L193F	probably damaging	Het
Fam13c	G	A	10: 70,553,069	S474N	probably benign	Het
Fam171a2	C	A	11: 102,437,867	V689L	possibly damaging	Het
Fastkd3	T	C	13: 68,584,585	F342L	probably benign	Het
Fat4	T	C	3: 38,995,946	S3986P	possibly damaging	Het
Fbxo38	A	G	18: 62,540,971	M13T	probably benign	Het
Fbxo48	G	T	11: 16,954,329	L160F	possibly damaging	Het
Fgr	G	A	4: 132,986,353		probably null	Het
Gbx2	T	C	1: 89,928,913	T252A	probably damaging	Het
Gm20671	A	G	5: 32,819,942	S1823P	probably damaging	Het
Gpatch8	A	T	11: 102,508,227		probably null	Het
Gsdma	A	T	11: 98,666,449		probably null	Het
Gucy2g	G	A	19: 55,215,116	A750V	probably damaging	Het
Hdac9	A	G	12: 34,429,558	Y223H	probably damaging	Het
Igsf5	C	A	16: 96,391,026	T275N	probably benign	Het
Il23r	G	A	6: 67,486,291	H73Y	probably benign	Het
Ipo4	G	T	14: 55,626,196	R1026S	probably benign	Het
Jade1	T	A	3: 41,591,702	I54N	probably damaging	Het
Khdrbs1	G	T	4: 129,741,936	D75E	possibly damaging	Het
Lrwd1	A	T	5: 136,123,874	D511E	possibly damaging	Het
Ly75	A	T	2: 60,334,487	C782*	probably null	Het
Mmp3	C	T	9: 7,451,759	R366*	probably null	Het
Mrgpra6	A	G	7: 47,188,881	C190R	probably damaging	Het
Myh10	T	A	11: 68,801,608	L1369Q	probably damaging	Het
Myof	C	T	19: 37,952,987	A792T	probably damaging	Het
Ncf1	A	G	5: 134,221,805	L373P	probably damaging	Het
Ncoa7	C	A	10: 30,722,817	A37S	probably benign	Het
Nfkb1	A	G	3: 135,612,542	V310A	possibly damaging	Het
Nmur2	T	A	11: 56,040,214	I224F	probably damaging	Het
Nr1d2	A	T	14: 18,211,922	S394T	probably benign	Het
Nudt12	A	G	17: 59,003,439	W390R	probably damaging	Het
Olfr1252	T	A	2: 89,721,305	I269F	possibly damaging	Het
Olfr1508	T	A	14: 52,463,257	T251S	probably benign	Het
Olfr165	A	G	16: 19,407,797	L73P	probably damaging	Het
Olfr243	T	C	7: 103,717,355	F254L	probably benign	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Pate2	A	G	9: 35,670,541	M44V	probably damaging	Het
Pikfyve	T	C	1: 65,244,409	L735S	probably damaging	Het
Plce1	C	A	19: 38,760,091	N1755K	probably damaging	Het
Pld1	C	A	3: 28,025,320	R90S	probably damaging	Het
Pnpla7	C	A	2: 25,041,019	P882Q	probably damaging	Het
Pold2	A	G	11: 5,876,760	L58P	probably damaging	Het
Ppm1d	A	G	11: 85,311,783	E104G	probably damaging	Het
Ppm1e	A	T	11: 87,358,551	L118Q	possibly damaging	Het
Ppp1r42	A	G	1: 9,999,435	L134P	probably damaging	Het
Prpf8	A	G	11: 75,495,799	D1038G	probably damaging	Het
Prss36	C	A	7: 127,936,699	R288L	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Psma3	G	T	12: 70,974,765	G7W	probably damaging	Het
Psmc3ip	A	T	11: 101,092,604		probably null	Het
Qser1	T	C	2: 104,786,642	E1275G	probably damaging	Het
Rai2	A	G	X: 161,778,640	N363S	probably benign	Het
Ranbp17	A	T	11: 33,219,241	V991D	possibly damaging	Het
Rcc2	A	T	4: 140,720,566	K468*	probably null	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Sec1	C	A	7: 45,678,840	R261L	probably benign	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Homo
Sgip1	G	A	4: 102,934,566	V362I	possibly damaging	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc12a9	A	T	5: 137,331,014	L126Q	probably damaging	Het
Slx4	A	G	16: 3,990,805	S424P	probably damaging	Het
Smg5	T	C	3: 88,351,293	S524P	probably damaging	Het
Sncaip	A	G	18: 52,885,041	D418G	probably damaging	Het
Soga3	A	G	10: 29,196,770	D686G	probably benign	Het
Spata31d1b	C	A	13: 59,718,218	T1060K	possibly damaging	Het
Spink6	A	G	18: 44,082,280	T66A	probably damaging	Het
Sppl2c	T	A	11: 104,187,301	I309K	possibly damaging	Het
Stk39	T	A	2: 68,410,039	D116V	probably damaging	Het
Supv3l1	A	T	10: 62,430,596	N600K	possibly damaging	Het
Svep1	T	C	4: 58,104,545	K1226R	possibly damaging	Het
Syne1	C	T	10: 5,041,494	V557I	probably benign	Het
Tas2r117	G	T	6: 132,803,154	S85I	probably benign	Het
Tcf20	T	A	15: 82,856,199	Q350H	probably damaging	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tfb2m	A	C	1: 179,545,872		probably null	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tpd52	A	T	3: 8,931,195		probably null	Het
Trappc8	A	T	18: 20,833,062		probably null	Het
Trbv30	A	G	6: 41,281,920	T88A	probably benign	Het
Trim40	T	A	17: 36,888,865	N107I	probably damaging	Het
Trim80	A	T	11: 115,448,017	T558S	probably benign	Het
Ttn	A	G	2: 76,878,348		probably benign	Het
Vav3	A	G	3: 109,527,475	M441V	possibly damaging	Het
Vmn1r42	T	A	6: 89,845,384	I68F	probably damaging	Het
Vmn2r118	C	T	17: 55,611,565	G109D	probably benign	Het
Vmn2r5	T	A	3: 64,509,510	M76L	probably benign	Het
Vwa7	G	T	17: 35,024,926		probably null	Het
Xndc1	T	C	7: 102,082,188	V378A	probably benign	Het
Zc3h12d	A	T	10: 7,853,250	D126V	probably damaging	Het
Zc3h13	A	G	14: 75,343,619	N1682S	probably benign	Het
Zc3h15	T	C	2: 83,660,230	I236T	possibly damaging	Het
Zfp13	A	T	17: 23,581,182	I34N	probably damaging	Het
Zfp169	A	T	13: 48,490,275	C459S	possibly damaging	Het
Zfyve28	A	G	5: 34,216,967	C568R	probably damaging	Het

Other mutations in C4b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:C4b	APN	17	34734428	missense	probably damaging	1.00
IGL00433:C4b	APN	17	34742041	missense	possibly damaging	0.75
IGL00471:C4b	APN	17	34734429	missense	probably damaging	1.00
IGL00515:C4b	APN	17	34728891	missense	probably damaging	1.00
IGL01599:C4b	APN	17	34743019	splice site	probably benign
IGL01761:C4b	APN	17	34739938	missense	possibly damaging	0.56
IGL02004:C4b	APN	17	34739010	unclassified	probably benign
IGL02215:C4b	APN	17	34734491	missense	probably damaging	1.00
IGL02517:C4b	APN	17	34734408	missense	probably benign	0.01
IGL02926:C4b	APN	17	34730712	missense	possibly damaging	0.95
IGL03031:C4b	APN	17	34731130	missense	possibly damaging	0.47
IGL03057:C4b	APN	17	34737764	unclassified	probably benign
IGL03165:C4b	APN	17	34739955	missense	probably benign	0.13
IGL03380:C4b	APN	17	34740286	missense	probably benign	0.01
Aspiration	UTSW	17	34734442	missense	probably benign	0.00
Inspiration	UTSW	17	34732166	splice site	probably null
Peroration	UTSW	17	34729399	critical splice donor site	probably null
perspiration	UTSW	17	34729831	missense	probably damaging	1.00
FR4548:C4b	UTSW	17	34740997	missense	probably benign	0.00
PIT4142001:C4b	UTSW	17	34733701	missense	probably benign	0.01
R0064:C4b	UTSW	17	34738856	missense	probably damaging	1.00
R0113:C4b	UTSW	17	34741240	missense	probably damaging	0.98
R0143:C4b	UTSW	17	34734219	unclassified	probably benign
R0254:C4b	UTSW	17	34734776	missense	probably benign	0.00
R0320:C4b	UTSW	17	34733161	missense	probably benign	0.01
R0391:C4b	UTSW	17	34735614	splice site	probably benign
R0399:C4b	UTSW	17	34728869	missense	probably damaging	1.00
R0467:C4b	UTSW	17	34736127	missense	probably benign	0.01
R0549:C4b	UTSW	17	34735415	missense	probably damaging	1.00
R0561:C4b	UTSW	17	34734417	missense	probably damaging	0.99
R0662:C4b	UTSW	17	34730888	missense	probably damaging	1.00
R0941:C4b	UTSW	17	34740055	missense	probably benign
R1161:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1169:C4b	UTSW	17	34742972	missense	probably benign	0.14
R1186:C4b	UTSW	17	34736309	missense	possibly damaging	0.47
R1310:C4b	UTSW	17	34729593	missense	probably damaging	1.00
R1398:C4b	UTSW	17	34730719	unclassified	probably benign
R1472:C4b	UTSW	17	34743769	nonsense	probably null
R1496:C4b	UTSW	17	34740021	missense	probably benign	0.30
R1544:C4b	UTSW	17	34738967	missense	probably benign	0.13
R1588:C4b	UTSW	17	34741025	missense	probably benign
R1645:C4b	UTSW	17	34740597	missense	probably damaging	1.00
R1664:C4b	UTSW	17	34732978	missense	probably damaging	1.00
R1678:C4b	UTSW	17	34743650	missense	probably benign	0.05
R1710:C4b	UTSW	17	34743664	splice site	probably benign
R1713:C4b	UTSW	17	34729271	splice site	probably benign
R1770:C4b	UTSW	17	34736927	missense	possibly damaging	0.78
R1859:C4b	UTSW	17	34735553	missense	probably benign
R1924:C4b	UTSW	17	34729657	missense	probably damaging	1.00
R2057:C4b	UTSW	17	34728620	missense	probably damaging	1.00
R2060:C4b	UTSW	17	34736101	missense	probably damaging	1.00
R2184:C4b	UTSW	17	34737702	missense	probably benign	0.27
R2306:C4b	UTSW	17	34728518	missense	probably benign	0.00
R2363:C4b	UTSW	17	34736058	splice site	probably benign
R2365:C4b	UTSW	17	34736058	splice site	probably benign
R2379:C4b	UTSW	17	34735743	missense	possibly damaging	0.81
R2860:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R2861:C4b	UTSW	17	34734758	missense	probably damaging	0.99
R3551:C4b	UTSW	17	34741872	missense	possibly damaging	0.75
R3765:C4b	UTSW	17	34729840	missense	probably damaging	0.98
R4157:C4b	UTSW	17	34742855	missense	probably damaging	1.00
R4299:C4b	UTSW	17	34731144	missense	possibly damaging	0.52
R4365:C4b	UTSW	17	34734743	missense	possibly damaging	0.65
R4411:C4b	UTSW	17	34728864	missense	probably damaging	1.00
R4613:C4b	UTSW	17	34734551	missense	probably benign	0.12
R4784:C4b	UTSW	17	34733406	missense	probably benign	0.00
R4790:C4b	UTSW	17	34734143	missense	probably benign	0.01
R4831:C4b	UTSW	17	34736890	splice site	probably null
R4879:C4b	UTSW	17	34743647	missense	probably damaging	0.99
R5036:C4b	UTSW	17	34740445	critical splice acceptor site	probably null
R5361:C4b	UTSW	17	34741238	missense	probably benign	0.15
R5518:C4b	UTSW	17	34734442	missense	probably benign	0.00
R5590:C4b	UTSW	17	34740335	missense	probably damaging	0.98
R5643:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5644:C4b	UTSW	17	34742417	missense	probably benign	0.01
R5833:C4b	UTSW	17	34730673	missense	probably damaging	1.00
R5931:C4b	UTSW	17	34729193	missense	probably damaging	0.99
R6178:C4b	UTSW	17	34733406	missense	probably benign	0.00
R6209:C4b	UTSW	17	34741087	missense	possibly damaging	0.93
R6225:C4b	UTSW	17	34738874	missense	possibly damaging	0.64
R6518:C4b	UTSW	17	34734205	missense	probably damaging	0.98
R6613:C4b	UTSW	17	34733565	missense	probably damaging	0.99
R6781:C4b	UTSW	17	34742954	missense	probably damaging	0.99
R6807:C4b	UTSW	17	34730956	missense	probably benign	0.17
R6858:C4b	UTSW	17	34729831	missense	probably damaging	1.00
R6962:C4b	UTSW	17	34732166	splice site	probably null
R7068:C4b	UTSW	17	34733477	missense	probably damaging	1.00
R7081:C4b	UTSW	17	34735443	missense	probably benign	0.27
R7105:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R7211:C4b	UTSW	17	34735534	missense	possibly damaging	0.92
R7296:C4b	UTSW	17	34743659	missense	probably damaging	1.00
R7314:C4b	UTSW	17	34740356	missense	probably benign
R7330:C4b	UTSW	17	34730472	missense	probably damaging	1.00
R7397:C4b	UTSW	17	34742390	missense	possibly damaging	0.80
R7437:C4b	UTSW	17	34734733	missense	probably benign	0.10
R7490:C4b	UTSW	17	34731080	nonsense	probably null
R7597:C4b	UTSW	17	34739675	missense	probably benign
R7633:C4b	UTSW	17	34729399	critical splice donor site	probably null
R7900:C4b	UTSW	17	34739777	missense	probably benign	0.03
R7910:C4b	UTSW	17	34740352	missense	probably benign	0.00
R7923:C4b	UTSW	17	34742380	missense	probably damaging	1.00
R7960:C4b	UTSW	17	34741278	splice site	probably null
R8420:C4b	UTSW	17	34734539	missense	probably damaging	0.97
R8467:C4b	UTSW	17	34732813	missense	possibly damaging	0.51
R8558:C4b	UTSW	17	34736567	missense	probably damaging	1.00
R8725:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8727:C4b	UTSW	17	34734485	missense	probably damaging	1.00
R8853:C4b	UTSW	17	34729905	missense	possibly damaging	0.91
R8934:C4b	UTSW	17	34732984	missense	possibly damaging	0.78
R8944:C4b	UTSW	17	34742939	missense	probably benign	0.00
R8960:C4b	UTSW	17	34733918	missense	probably damaging	1.00
R8982:C4b	UTSW	17	34734364	critical splice donor site	probably null
R9104:C4b	UTSW	17	34729259	missense	probably benign	0.39
R9114:C4b	UTSW	17	34729430	missense	probably damaging	0.99
R9348:C4b	UTSW	17	34733185	missense	probably benign	0.01
R9428:C4b	UTSW	17	34730911	missense	possibly damaging	0.52
R9533:C4b	UTSW	17	34737724	nonsense	probably null
R9591:C4b	UTSW	17	34738955	missense	probably benign	0.00
R9678:C4b	UTSW	17	34741789	critical splice donor site	probably null
Z1176:C4b	UTSW	17	34731147	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CCCAGCCTTTAGACCCCTG -3'
(R):5'- ACCCTCAGCTGAGTGGCA -3'

Sequencing Primer
(F):5'- GAGACCCAACTGTAAGGCATTTTCTC -3'
(R):5'- AGATCCTGCTCCTCAGTTGC -3'

Posted On

2016-08-04