Incidental Mutation 'R5385:Arhgap30'
ID425026
Institutional Source Beutler Lab
Gene Symbol Arhgap30
Ensembl Gene ENSMUSG00000048865
Gene NameRho GTPase activating protein 30
Synonyms6030405P05Rik
Accession Numbers

Ncbi RefSeq: NM_001005508.2; MGI: 2684948

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5385 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location171388954-171410298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 171408280 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 741 (R741G)
Ref Sequence ENSEMBL: ENSMUSP00000059389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001284] [ENSMUST00000056449] [ENSMUST00000159207] [ENSMUST00000160486] [ENSMUST00000161241] [ENSMUST00000167546]
Predicted Effect probably benign
Transcript: ENSMUST00000001284
Predicted Effect probably benign
Transcript: ENSMUST00000056449
AA Change: R741G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000059389
Gene: ENSMUSG00000048865
AA Change: R741G

DomainStartEndE-ValueType
low complexity region 6 14 N/A INTRINSIC
RhoGAP 31 212 1.4e-61 SMART
Blast:RhoGAP 225 285 2e-24 BLAST
low complexity region 348 366 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
low complexity region 452 463 N/A INTRINSIC
low complexity region 498 510 N/A INTRINSIC
low complexity region 514 534 N/A INTRINSIC
low complexity region 667 690 N/A INTRINSIC
low complexity region 736 752 N/A INTRINSIC
low complexity region 924 940 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131607
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135312
Predicted Effect probably benign
Transcript: ENSMUST00000159207
SMART Domains Protein: ENSMUSP00000124000
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159466
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160335
Predicted Effect probably benign
Transcript: ENSMUST00000160486
SMART Domains Protein: ENSMUSP00000125363
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161241
SMART Domains Protein: ENSMUSP00000125729
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161297
Predicted Effect probably benign
Transcript: ENSMUST00000167546
SMART Domains Protein: ENSMUSP00000128913
Gene: ENSMUSG00000026641

DomainStartEndE-ValueType
low complexity region 121 145 N/A INTRINSIC
HLH 205 260 5.01e-15 SMART
low complexity region 265 281 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a T C 10: 80,585,612 T175A probably benign Het
Adam23 A G 1: 63,551,811 D479G possibly damaging Het
Adgrl3 T G 5: 81,726,801 Y1050D probably damaging Het
Ago4 A G 4: 126,517,556 I103T probably benign Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Alyref2 A G 1: 171,503,703 N16S probably benign Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Ap2b1 T C 11: 83,342,601 V480A probably damaging Het
Canx A G 11: 50,301,812 L325P probably damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdc37l1 T G 19: 29,011,943 S267A possibly damaging Het
Ces1f A T 8: 93,265,760 C354* probably null Het
Col4a3bp A G 13: 96,629,067 T447A possibly damaging Het
Cpne1 A T 2: 156,074,364 V350D probably damaging Het
Ctdsp2 A G 10: 126,996,457 T262A probably benign Het
Cypt4 A G 9: 24,625,300 K29E possibly damaging Het
Dlg2 T C 7: 92,088,576 V422A probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah3 T A 7: 119,924,903 K3953N probably damaging Het
Dnmt1 A G 9: 20,918,480 V647A probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat3 A T 9: 15,922,675 L4207Q possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fer1l4 G A 2: 156,037,366 Q906* probably null Het
Fpr2 C A 17: 17,893,047 H102N probably benign Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpr107 A G 2: 31,214,251 T523A probably benign Het
Grin3a G A 4: 49,719,313 P811L probably damaging Het
Hivep1 A T 13: 42,164,395 probably null Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Hpse C T 5: 100,708,724 W136* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ifnar2 T A 16: 91,404,198 D442E possibly damaging Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh4 T C 11: 100,752,250 D397G probably damaging Het
Kcnj1 A G 9: 32,396,723 R148G probably damaging Het
Lct T G 1: 128,311,617 K277N possibly damaging Het
Loxl3 A G 6: 83,050,612 M712V probably damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Marcks A G 10: 37,138,457 S27P probably damaging Het
Mef2c A G 13: 83,662,413 T347A probably benign Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Msc C A 1: 14,755,420 R110L probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nop2 T C 6: 125,144,361 V702A probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1418 T A 19: 11,855,177 I259F probably damaging Het
Olfr160 A T 9: 37,712,021 V86E probably damaging Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr366 G T 2: 37,219,587 A33S possibly damaging Het
Olfr430 A T 1: 174,069,470 K57N probably benign Het
Olfr558 T C 7: 102,709,346 L29P probably damaging Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr784 A G 10: 129,387,764 I44V probably benign Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Otub2 G A 12: 103,392,796 probably benign Het
Pck2 A G 14: 55,545,231 E339G probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pdpk1 G A 17: 24,098,140 Q250* probably null Het
Pigb T A 9: 73,039,545 H16L probably benign Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plekhh2 T C 17: 84,557,466 V94A probably benign Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Prex2 A G 1: 11,139,980 D548G probably damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Riox2 T A 16: 59,486,616 M290K probably benign Het
Rnpepl1 T A 1: 92,917,192 L402Q probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sesn2 A G 4: 132,499,264 I173T probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc13a5 T A 11: 72,259,077 E159D probably benign Het
Slc16a7 A G 10: 125,294,604 Y71H possibly damaging Het
Slc4a7 T C 14: 14,773,345 F772L possibly damaging Het
Snapc4 A G 2: 26,374,503 S275P probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Sspo C T 6: 48,462,253 P1612S probably benign Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tanc2 T A 11: 105,776,846 D84E probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfip11 T C 5: 112,331,220 probably null Het
Thtpa G T 14: 55,095,833 R125L probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmcc3 A T 10: 94,579,153 N239I probably damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Traf6 T A 2: 101,684,755 C85* probably null Het
Trim68 T G 7: 102,678,783 D321A probably damaging Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttbk1 T C 17: 46,447,632 D692G probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ttc6 T A 12: 57,643,035 probably null Het
Txnrd2 T G 16: 18,477,692 I468S probably damaging Het
Ube2b A T 11: 51,988,644 Y100N probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Uggt1 A G 1: 36,184,412 Y599H probably damaging Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn2r1 T A 3: 64,101,398 D499E possibly damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zcchc6 A T 13: 59,789,846 probably null Het
Zmiz1 A T 14: 25,649,813 Y459F probably damaging Het
Other mutations in Arhgap30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01638:Arhgap30 APN 1 171397570 missense probably damaging 1.00
IGL02016:Arhgap30 APN 1 171407747 missense probably damaging 1.00
IGL02552:Arhgap30 APN 1 171407756 missense probably damaging 1.00
IGL03343:Arhgap30 APN 1 171409094 missense probably damaging 1.00
FR4304:Arhgap30 UTSW 1 171405168 small insertion probably benign
P0017:Arhgap30 UTSW 1 171408704 missense probably benign 0.02
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0045:Arhgap30 UTSW 1 171408430 missense probably benign
R0115:Arhgap30 UTSW 1 171407948 missense possibly damaging 0.92
R0320:Arhgap30 UTSW 1 171403804 missense possibly damaging 0.81
R0399:Arhgap30 UTSW 1 171404816 missense probably damaging 0.97
R0945:Arhgap30 UTSW 1 171403286 missense probably damaging 1.00
R1484:Arhgap30 UTSW 1 171403271 missense probably damaging 1.00
R1595:Arhgap30 UTSW 1 171408341 missense probably benign
R2173:Arhgap30 UTSW 1 171407767 missense probably damaging 1.00
R2281:Arhgap30 UTSW 1 171389328 missense probably damaging 1.00
R2864:Arhgap30 UTSW 1 171408206 missense probably damaging 1.00
R4066:Arhgap30 UTSW 1 171408323 missense probably benign
R4888:Arhgap30 UTSW 1 171409312 missense probably benign
R4937:Arhgap30 UTSW 1 171403329 missense probably benign 0.03
R4944:Arhgap30 UTSW 1 171402254 missense probably damaging 1.00
R5170:Arhgap30 UTSW 1 171408050 missense probably benign 0.00
R5218:Arhgap30 UTSW 1 171408760 missense probably benign
R5541:Arhgap30 UTSW 1 171404139 critical splice donor site probably null
R6028:Arhgap30 UTSW 1 171408320 missense probably benign
R6747:Arhgap30 UTSW 1 171407729 missense probably damaging 1.00
R6748:Arhgap30 UTSW 1 171404810 missense possibly damaging 0.50
R6869:Arhgap30 UTSW 1 171409055 missense probably damaging 1.00
R7223:Arhgap30 UTSW 1 171407571 missense probably damaging 1.00
X0020:Arhgap30 UTSW 1 171405085 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AGGCTGGAAAGGCTGATGC -3'
(R):5'- GTCTTCACTGTGTCCTTGGT -3'

Sequencing Primer
(F):5'- CTGGAAAGGCTGATGCGGAAG -3'
(R):5'- TGGTCTTCTCTTGACTTAAGGTC -3'
Posted On2016-08-04