Incidental Mutation 'R5385:Hmcn2'
ID425036
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Namehemicentin 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5385 (G1)
Quality Score186
Status Not validated
Chromosome2
Chromosomal Location31314415-31460738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31460321 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 5077 (T5077A)
Ref Sequence ENSEMBL: ENSMUSP00000109160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
Predicted Effect probably benign
Transcript: ENSMUST00000113532
AA Change: T5077A

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632
AA Change: T5077A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142448
Predicted Effect probably benign
Transcript: ENSMUST00000226996
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a T C 10: 80,585,612 T175A probably benign Het
Adam23 A G 1: 63,551,811 D479G possibly damaging Het
Adgrl3 T G 5: 81,726,801 Y1050D probably damaging Het
Ago4 A G 4: 126,517,556 I103T probably benign Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Alyref2 A G 1: 171,503,703 N16S probably benign Het
Ankhd1 A G 18: 36,591,495 E402G probably damaging Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Ap2b1 T C 11: 83,342,601 V480A probably damaging Het
Arhgap30 A G 1: 171,408,280 R741G probably benign Het
Canx A G 11: 50,301,812 L325P probably damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdc37l1 T G 19: 29,011,943 S267A possibly damaging Het
Ces1f A T 8: 93,265,760 C354* probably null Het
Col4a3bp A G 13: 96,629,067 T447A possibly damaging Het
Cpne1 A T 2: 156,074,364 V350D probably damaging Het
Ctdsp2 A G 10: 126,996,457 T262A probably benign Het
Cypt4 A G 9: 24,625,300 K29E possibly damaging Het
Dlg2 T C 7: 92,088,576 V422A probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah3 T A 7: 119,924,903 K3953N probably damaging Het
Dnmt1 A G 9: 20,918,480 V647A probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat3 A T 9: 15,922,675 L4207Q possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fer1l4 G A 2: 156,037,366 Q906* probably null Het
Fpr2 C A 17: 17,893,047 H102N probably benign Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpr107 A G 2: 31,214,251 T523A probably benign Het
Grin3a G A 4: 49,719,313 P811L probably damaging Het
Hivep1 A T 13: 42,164,395 probably null Het
Hpse C T 5: 100,708,724 W136* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ifnar2 T A 16: 91,404,198 D442E possibly damaging Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh4 T C 11: 100,752,250 D397G probably damaging Het
Kcnj1 A G 9: 32,396,723 R148G probably damaging Het
Lct T G 1: 128,311,617 K277N possibly damaging Het
Loxl3 A G 6: 83,050,612 M712V probably damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Marcks A G 10: 37,138,457 S27P probably damaging Het
Mef2c A G 13: 83,662,413 T347A probably benign Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Msc C A 1: 14,755,420 R110L probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nop2 T C 6: 125,144,361 V702A probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1418 T A 19: 11,855,177 I259F probably damaging Het
Olfr160 A T 9: 37,712,021 V86E probably damaging Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr366 G T 2: 37,219,587 A33S possibly damaging Het
Olfr430 A T 1: 174,069,470 K57N probably benign Het
Olfr558 T C 7: 102,709,346 L29P probably damaging Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr784 A G 10: 129,387,764 I44V probably benign Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Otub2 G A 12: 103,392,796 probably benign Het
Pck2 A G 14: 55,545,231 E339G probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pdpk1 G A 17: 24,098,140 Q250* probably null Het
Pigb T A 9: 73,039,545 H16L probably benign Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plekhh2 T C 17: 84,557,466 V94A probably benign Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Prex2 A G 1: 11,139,980 D548G probably damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Riox2 T A 16: 59,486,616 M290K probably benign Het
Rnpepl1 T A 1: 92,917,192 L402Q probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sesn2 A G 4: 132,499,264 I173T probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc13a5 T A 11: 72,259,077 E159D probably benign Het
Slc16a7 A G 10: 125,294,604 Y71H possibly damaging Het
Slc4a7 T C 14: 14,773,345 F772L possibly damaging Het
Snapc4 A G 2: 26,374,503 S275P probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Sspo C T 6: 48,462,253 P1612S probably benign Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tanc2 T A 11: 105,776,846 D84E probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfip11 T C 5: 112,331,220 probably null Het
Thtpa G T 14: 55,095,833 R125L probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmcc3 A T 10: 94,579,153 N239I probably damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Traf6 T A 2: 101,684,755 C85* probably null Het
Trim68 T G 7: 102,678,783 D321A probably damaging Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttbk1 T C 17: 46,447,632 D692G probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ttc6 T A 12: 57,643,035 probably null Het
Txnrd2 T G 16: 18,477,692 I468S probably damaging Het
Ube2b A T 11: 51,988,644 Y100N probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Uggt1 A G 1: 36,184,412 Y599H probably damaging Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn2r1 T A 3: 64,101,398 D499E possibly damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zcchc6 A T 13: 59,789,846 probably null Het
Zmiz1 A T 14: 25,649,813 Y459F probably damaging Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31343096 missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31428994 missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31383821 intron probably benign
IGL01364:Hmcn2 APN 2 31361814 nonsense probably null
IGL01486:Hmcn2 APN 2 31336621 missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31354264 missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31424252 missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31343102 missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31405630 missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31398917 missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31428982 missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31457173 missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31400127 missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31424377 missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31453605 missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31450952 missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31420095 missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31454811 missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31408973 missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31405528 missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31346590 missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31413367 nonsense probably null
IGL03003:Hmcn2 APN 2 31433486 missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31346630 missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31362230 missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31346621 missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31346637 missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31428250 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31388344 missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31426198 missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31438331 critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31369164 splice site probably benign
R0266:Hmcn2 UTSW 2 31394827 missense probably benign 0.03
R0266:Hmcn2 UTSW 2 31445353 splice site probably benign
R0326:Hmcn2 UTSW 2 31423225 nonsense probably null
R0366:Hmcn2 UTSW 2 31424206 missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31400129 missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31388247 missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31405612 missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31415284 critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31386677 missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31415236 missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31453160 missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31391511 missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31346495 missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31314479 missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31420407 missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31430787 missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31458039 missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31450844 missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31354721 missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31457985 missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31396120 missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31314590 missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31393043 missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31383692 missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31415283 critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31411910 critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31389329 missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31438255 missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31335436 missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31378282 missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31380419 missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31333931 splice site probably benign
R2155:Hmcn2 UTSW 2 31460349 missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31380281 missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31419935 missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31380297 missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31350574 missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31335412 critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31388298 missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31460210 missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31360998 missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31400255 missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31433272 splice site probably benign
R3429:Hmcn2 UTSW 2 31409144 missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31336612 nonsense probably null
R3739:Hmcn2 UTSW 2 31336612 nonsense probably null
R3771:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31352885 splice site probably null
R3837:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31430350 missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31453157 missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31380484 critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31382394 missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31336612 nonsense probably null
R4057:Hmcn2 UTSW 2 31400238 missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31413265 missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31396710 missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31399019 missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31438285 missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31383775 missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31445314 missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31360980 missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31335492 missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31354164 critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31344096 missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31393025 missense possibly damaging 0.88
R4994:Hmcn2 UTSW 2 31458055 critical splice donor site probably null
R4997:Hmcn2 UTSW 2 31401708 missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31409081 missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31458049 missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31389443 missense probably null
R5232:Hmcn2 UTSW 2 31457748 missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31414716 missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31430441 missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31409011 missense probably damaging 0.99
R5412:Hmcn2 UTSW 2 31346617 missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31336544 missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31420363 missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31406416 missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31393054 nonsense probably null
R5492:Hmcn2 UTSW 2 31420306 missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31414525 critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31414526 critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31344047 missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31428303 missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31333881 missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31420812 missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31336567 missense probably damaging 1.00
R5716:Hmcn2 UTSW 2 31458738 missense possibly damaging 0.68
R5725:Hmcn2 UTSW 2 31383815 critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31414568 missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31409135 missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31457807 missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31354673 missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31396139 missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31420323 missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31420309 missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31370792 missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31434713 missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31356254 missense probably benign
R6166:Hmcn2 UTSW 2 31369262 missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31420106 nonsense probably null
R6191:Hmcn2 UTSW 2 31458746 missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31384115 missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31411834 missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31388373 missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31369257 missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31420820 missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31361800 missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31425468 missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31382478 missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31356342 missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31415268 missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31343056 missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31350505 splice site probably null
R6971:Hmcn2 UTSW 2 31432321 missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31422649 missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31360896 missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31457966 missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31343081 missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31459081 missense probably damaging 0.99
R7334:Hmcn2 UTSW 2 31435794 missense probably damaging 0.98
R7334:Hmcn2 UTSW 2 31453135 missense possibly damaging 0.82
R7335:Hmcn2 UTSW 2 31392157 missense possibly damaging 0.88
R7358:Hmcn2 UTSW 2 31416812 missense probably damaging 1.00
R7359:Hmcn2 UTSW 2 31388383 missense probably benign 0.13
R7488:Hmcn2 UTSW 2 31420830 missense probably damaging 1.00
R7498:Hmcn2 UTSW 2 31383475 intron probably null
R7560:Hmcn2 UTSW 2 31457173 missense probably benign
R7566:Hmcn2 UTSW 2 31454857 missense probably damaging 0.96
R7570:Hmcn2 UTSW 2 31423911 missense probably benign
R7574:Hmcn2 UTSW 2 31455519 missense possibly damaging 0.68
R7599:Hmcn2 UTSW 2 31356286 missense possibly damaging 0.93
R7654:Hmcn2 UTSW 2 31346569 missense probably benign 0.00
R7662:Hmcn2 UTSW 2 31382345 missense probably benign 0.01
R7666:Hmcn2 UTSW 2 31380233 missense probably damaging 1.00
R7698:Hmcn2 UTSW 2 31423153 missense probably damaging 0.98
R7722:Hmcn2 UTSW 2 31382500 nonsense probably null
R7739:Hmcn2 UTSW 2 31458026 missense possibly damaging 0.48
R7828:Hmcn2 UTSW 2 31405875 missense possibly damaging 0.95
X0066:Hmcn2 UTSW 2 31454811 missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31405867 missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31459064 intron probably null
Z1088:Hmcn2 UTSW 2 31381067 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGAGCTTGTCTGTGTCACC -3'
(R):5'- CGGGAGAAGAGGATGTTCTC -3'

Sequencing Primer
(F):5'- TACACTGCAGTACCGCCTG -3'
(R):5'- AGAAGAGGATGTTCTCTGTCAC -3'
Posted On2016-08-04