Incidental Mutation 'R0491:Olfr1475'
Institutional Source Beutler Lab
Gene Symbol Olfr1475
Ensembl Gene ENSMUSG00000096708
Gene Nameolfactory receptor 1475
SynonymsGA_x6K02T2RE5P-3812807-3811863, MOR202-36
MMRRC Submission 038689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R0491 (G1)
Quality Score225
Status Validated
Chromosomal Location13479252-13480196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13479493 bp
Amino Acid Change Alanine to Valine at position 235 (A235V)
Ref Sequence ENSEMBL: ENSMUSP00000079616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080801]
Predicted Effect probably damaging
Transcript: ENSMUST00000080801
AA Change: A235V

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079616
Gene: ENSMUSG00000096708
AA Change: A235V

Pfam:7tm_4 29 306 4.2e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 303 4.7e-9 PFAM
Pfam:7tm_1 39 288 1.6e-20 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.4%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,182,243 S356T probably damaging Het
Abca13 T C 11: 9,298,235 F2661L probably benign Het
Acadsb A G 7: 131,430,107 D224G probably benign Het
Acsm1 A G 7: 119,640,697 H288R probably damaging Het
Adamts2 A G 11: 50,776,630 D465G probably damaging Het
Akap9 A T 5: 3,972,851 probably benign Het
Alms1 A G 6: 85,702,600 T3240A probably damaging Het
Ap3d1 A G 10: 80,719,241 W417R probably damaging Het
Arfgef1 C A 1: 10,179,987 probably benign Het
Atf6 A G 1: 170,787,344 probably null Het
Cacna1s T A 1: 136,089,008 probably benign Het
Clcn1 T C 6: 42,310,581 F740L probably benign Het
Clec12a T A 6: 129,364,053 D265E probably benign Het
Clic3 T A 2: 25,457,785 probably benign Het
Cntnap3 T G 13: 64,762,045 T749P probably benign Het
Col11a2 T A 17: 34,042,212 D45E probably null Het
Crxos T A 7: 15,898,535 S89T probably benign Het
Cxcr1 G T 1: 74,192,309 P185T possibly damaging Het
Cyp20a1 T A 1: 60,371,327 N262K possibly damaging Het
Dpy19l2 T C 9: 24,696,028 R46G probably benign Het
Dpysl2 A T 14: 66,807,962 L454Q probably damaging Het
Dvl3 C T 16: 20,527,423 probably benign Het
Eppin T A 2: 164,589,412 E98V possibly damaging Het
Fancm A T 12: 65,106,061 H1097L probably benign Het
Fkbp4 A G 6: 128,435,742 I75T probably damaging Het
Fmn2 A G 1: 174,581,959 H586R unknown Het
Gm973 C T 1: 59,558,234 probably benign Het
Haus6 A C 4: 86,602,846 V185G possibly damaging Het
Herc2 T A 7: 56,122,366 C1098S possibly damaging Het
Hic1 C A 11: 75,166,310 L584F possibly damaging Het
Itgb1bp1 C A 12: 21,276,895 probably benign Het
Kbtbd2 G A 6: 56,780,389 R121* probably null Het
Lgr4 C T 2: 110,007,281 probably benign Het
Lrrc55 T C 2: 85,191,920 E309G probably damaging Het
Mertk T C 2: 128,793,107 probably null Het
Micu3 A G 8: 40,366,253 probably benign Het
Mmp11 G A 10: 75,926,758 A287V probably benign Het
Mpzl2 A G 9: 45,042,741 Y47C probably damaging Het
Muc5b A C 7: 141,862,015 R2899S probably benign Het
Myo1b A G 1: 51,755,698 Y1078H probably benign Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Ncapd3 T G 9: 27,057,883 V611G probably damaging Het
Ntpcr C T 8: 125,737,354 R73* probably null Het
Olfr1225 A T 2: 89,170,360 V284E probably benign Het
Osbp2 A G 11: 3,714,709 F88S probably damaging Het
Pkn3 A T 2: 30,089,877 T711S probably damaging Het
Plekhm1 T C 11: 103,394,776 K278E probably benign Het
Ppp1r36 A G 12: 76,439,291 T408A probably benign Het
Prss41 T C 17: 23,842,503 T105A possibly damaging Het
Psme1 G T 14: 55,579,921 probably benign Het
Ptprq A T 10: 107,608,175 Y1523N probably damaging Het
Ric8b A G 10: 84,992,222 D470G probably damaging Het
Scarb1 A G 5: 125,298,731 probably benign Het
Slc25a54 G A 3: 109,102,796 A204T probably damaging Het
Spink10 T C 18: 62,659,965 C67R probably damaging Het
St5 T A 7: 109,557,204 Q113L probably benign Het
Tmtc1 A T 6: 148,412,640 probably null Het
Tprkb A G 6: 85,924,464 D28G probably benign Het
Ttll13 A G 7: 80,260,350 H747R probably benign Het
Usp24 A G 4: 106,402,105 S1608G probably benign Het
Utp20 A T 10: 88,760,912 F2115L probably damaging Het
Vmn1r200 A T 13: 22,395,191 I46L probably benign Het
Zdhhc8 A T 16: 18,228,390 M103K probably damaging Het
Zfp595 C T 13: 67,317,305 G298E probably damaging Het
Zfp738 T G 13: 67,670,021 H617P possibly damaging Het
Zfp9 A T 6: 118,465,202 H166Q probably damaging Het
Zp3r C A 1: 130,618,334 D80Y probably damaging Het
Other mutations in Olfr1475
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Olfr1475 APN 19 13479787 missense possibly damaging 0.81
IGL01604:Olfr1475 APN 19 13479248 unclassified probably benign
IGL01656:Olfr1475 APN 19 13480090 missense probably benign 0.08
IGL01802:Olfr1475 APN 19 13479365 missense probably benign 0.05
IGL01839:Olfr1475 APN 19 13479440 missense probably benign
IGL02255:Olfr1475 APN 19 13479985 missense probably damaging 1.00
IGL02706:Olfr1475 APN 19 13480098 nonsense probably null
IGL02723:Olfr1475 APN 19 13479335 missense probably damaging 1.00
IGL03143:Olfr1475 APN 19 13479471 missense probably damaging 1.00
IGL03174:Olfr1475 APN 19 13480069 missense probably benign 0.10
R0442:Olfr1475 UTSW 19 13480048 missense probably damaging 1.00
R0490:Olfr1475 UTSW 19 13479493 missense probably damaging 0.98
R1757:Olfr1475 UTSW 19 13479607 missense possibly damaging 0.67
R1843:Olfr1475 UTSW 19 13479931 missense probably benign 0.00
R1972:Olfr1475 UTSW 19 13479694 missense probably benign 0.00
R2137:Olfr1475 UTSW 19 13479809 missense probably damaging 1.00
R3150:Olfr1475 UTSW 19 13479460 missense probably damaging 1.00
R3858:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3859:Olfr1475 UTSW 19 13480130 missense possibly damaging 0.86
R3953:Olfr1475 UTSW 19 13479442 missense probably benign 0.43
R4611:Olfr1475 UTSW 19 13480012 missense probably damaging 0.96
R4934:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R5580:Olfr1475 UTSW 19 13479427 missense probably damaging 1.00
R6278:Olfr1475 UTSW 19 13479755 missense probably benign
R6444:Olfr1475 UTSW 19 13479430 missense possibly damaging 0.95
R6796:Olfr1475 UTSW 19 13479914 missense probably damaging 1.00
R6812:Olfr1475 UTSW 19 13479611 missense probably benign 0.03
R7608:Olfr1475 UTSW 19 13479592 missense possibly damaging 0.65
R7632:Olfr1475 UTSW 19 13479431 missense possibly damaging 0.79
R8008:Olfr1475 UTSW 19 13479806 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ccctgcactatactaccattatgac -3'
Posted On2013-05-23