Mutagenetix > Incidental Mutation

Incidental Mutation 'R5385:Stard9'

425046

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R5385 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 120700630 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 2456 (E2456G)

Ref Sequence

ENSEMBL: ENSMUSP00000136055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000154193] [ENSMUST00000180041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000070420

SMART Domains

Protein: ENSMUSP00000070111
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
coiled coil region	97	138	N/A	INTRINSIC
low complexity region	142	151	N/A	INTRINSIC
low complexity region	157	174	N/A	INTRINSIC
low complexity region	234	255	N/A	INTRINSIC
Pfam:START	274	469	3.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000154193

SMART Domains

Protein: ENSMUSP00000116900
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
low complexity region	63	77	N/A	INTRINSIC
coiled coil region	409	450	N/A	INTRINSIC
low complexity region	454	463	N/A	INTRINSIC
low complexity region	469	486	N/A	INTRINSIC
low complexity region	546	567	N/A	INTRINSIC
SCOP:d1jssa_	588	784	4e-29	SMART
Blast:START	589	785	6e-12	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000180041
AA Change: E2456G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705
AA Change: E2456G

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 129 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17a	T	C	10: 80,585,612	T175A	probably benign	Het
Adam23	A	G	1: 63,551,811	D479G	possibly damaging	Het
Adgrl3	T	G	5: 81,726,801	Y1050D	probably damaging	Het
Ago4	A	G	4: 126,517,556	I103T	probably benign	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Aldh7a1	T	A	18: 56,534,253	N316Y	possibly damaging	Het
Alyref2	A	G	1: 171,503,703	N16S	probably benign	Het
Ankhd1	A	G	18: 36,591,495	E402G	probably damaging	Het
Ankrd36	A	G	11: 5,689,340		probably benign	Het
Ap2b1	T	C	11: 83,342,601	V480A	probably damaging	Het
Arhgap30	A	G	1: 171,408,280	R741G	probably benign	Het
Canx	A	G	11: 50,301,812	L325P	probably damaging	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cdc37l1	T	G	19: 29,011,943	S267A	possibly damaging	Het
Ces1f	A	T	8: 93,265,760	C354*	probably null	Het
Col4a3bp	A	G	13: 96,629,067	T447A	possibly damaging	Het
Cpne1	A	T	2: 156,074,364	V350D	probably damaging	Het
Ctdsp2	A	G	10: 126,996,457	T262A	probably benign	Het
Cypt4	A	G	9: 24,625,300	K29E	possibly damaging	Het
Dlg2	T	C	7: 92,088,576	V422A	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnah3	T	A	7: 119,924,903	K3953N	probably damaging	Het
Dnmt1	A	G	9: 20,918,480	V647A	probably damaging	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Dync2h1	T	C	9: 7,016,791	D3573G	probably damaging	Het
Ears2	G	C	7: 122,044,377	T426S	probably benign	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fat3	A	T	9: 15,922,675	L4207Q	possibly damaging	Het
Fbxo38	A	G	18: 62,540,971	M13T	probably benign	Het
Fbxo48	G	T	11: 16,954,329	L160F	possibly damaging	Het
Fer1l4	G	A	2: 156,037,366	Q906*	probably null	Het
Fpr2	C	A	17: 17,893,047	H102N	probably benign	Het
Gm10134	T	A	2: 28,506,360		probably benign	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gpr107	A	G	2: 31,214,251	T523A	probably benign	Het
Grin3a	G	A	4: 49,719,313	P811L	probably damaging	Het
Hivep1	A	T	13: 42,164,395		probably null	Het
Hmcn2	A	G	2: 31,460,321	T5077A	probably benign	Het
Hpse	C	T	5: 100,708,724	W136*	probably null	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Ifnar2	T	A	16: 91,404,198	D442E	possibly damaging	Het
Jade1	T	A	3: 41,591,702	I54N	probably damaging	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kcnh4	T	C	11: 100,752,250	D397G	probably damaging	Het
Kcnj1	A	G	9: 32,396,723	R148G	probably damaging	Het
Lct	T	G	1: 128,311,617	K277N	possibly damaging	Het
Loxl3	A	G	6: 83,050,612	M712V	probably damaging	Het
Ly75	A	G	2: 60,303,641	C1547R	probably damaging	Het
Marcks	A	G	10: 37,138,457	S27P	probably damaging	Het
Mef2c	A	G	13: 83,662,413	T347A	probably benign	Het
Mmp3	C	T	9: 7,451,759	R366*	probably null	Het
Mrgprx2	T	C	7: 48,483,005	T22A	probably benign	Het
Msc	C	A	1: 14,755,420	R110L	probably damaging	Het
Myh11	A	T	16: 14,208,008	V1366D	possibly damaging	Het
Ncf1	A	G	5: 134,221,805	L373P	probably damaging	Het
Neb	A	T	2: 52,189,861	I85N	probably damaging	Het
Nfkb1	A	G	3: 135,612,542	V310A	possibly damaging	Het
Nop2	T	C	6: 125,144,361	V702A	probably benign	Het
Nudt12	A	G	17: 59,003,439	W390R	probably damaging	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1418	T	A	19: 11,855,177	I259F	probably damaging	Het
Olfr160	A	T	9: 37,712,021	V86E	probably damaging	Het
Olfr251	A	T	9: 38,377,985	I29F	probably benign	Het
Olfr366	G	T	2: 37,219,587	A33S	possibly damaging	Het
Olfr430	A	T	1: 174,069,470	K57N	probably benign	Het
Olfr558	T	C	7: 102,709,346	L29P	probably damaging	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Olfr784	A	G	10: 129,387,764	I44V	probably benign	Het
Olfr971	A	G	9: 39,839,830	Y132C	possibly damaging	Het
Otub2	G	A	12: 103,392,796		probably benign	Het
Pck2	A	G	14: 55,545,231	E339G	probably damaging	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pdpk1	G	A	17: 24,098,140	Q250*	probably null	Het
Pigb	T	A	9: 73,039,545	H16L	probably benign	Het
Pitpnm1	T	C	19: 4,103,435	F197S	probably damaging	Het
Plekhh2	T	C	17: 84,557,466	V94A	probably benign	Het
Pnpla7	C	A	2: 25,041,019	P882Q	probably damaging	Het
Pold2	A	G	11: 5,876,760	L58P	probably damaging	Het
Pomt1	C	G	2: 32,244,299	Y277*	probably null	Het
Prex2	A	G	1: 11,139,980	D548G	probably damaging	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Rai2	A	G	X: 161,778,640	N363S	probably benign	Het
Ranbp17	A	T	11: 33,219,241	V991D	possibly damaging	Het
Riox2	T	A	16: 59,486,616	M290K	probably benign	Het
Rnpepl1	T	A	1: 92,917,192	L402Q	probably damaging	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Sesn2	A	G	4: 132,499,264	I173T	probably damaging	Het
Setx	T	G	2: 29,134,033		probably null	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc13a5	T	A	11: 72,259,077	E159D	probably benign	Het
Slc16a7	A	G	10: 125,294,604	Y71H	possibly damaging	Het
Slc4a7	T	C	14: 14,773,345	F772L	possibly damaging	Het
Snapc4	A	G	2: 26,374,503	S275P	probably benign	Het
Soga3	A	G	10: 29,196,770	D686G	probably benign	Het
Sorl1	T	C	9: 42,057,284	T558A	possibly damaging	Het
Sspo	C	T	6: 48,462,253	P1612S	probably benign	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Supv3l1	A	T	10: 62,430,596	N600K	possibly damaging	Het
Syne1	C	T	10: 5,041,494	V557I	probably benign	Het
Tanc2	T	A	11: 105,776,846	D84E	probably damaging	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tfip11	T	C	5: 112,331,220		probably null	Het
Thtpa	G	T	14: 55,095,833	R125L	probably damaging	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tmcc3	A	T	10: 94,579,153	N239I	probably damaging	Het
Tpd52	A	T	3: 8,931,195		probably null	Het
Traf6	T	A	2: 101,684,755	C85*	probably null	Het
Trim68	T	G	7: 102,678,783	D321A	probably damaging	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Ttbk1	T	C	17: 46,447,632	D692G	probably benign	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Ttc6	T	A	12: 57,643,035		probably null	Het
Txnrd2	T	G	16: 18,477,692	I468S	probably damaging	Het
Ube2b	A	T	11: 51,988,644	Y100N	probably damaging	Het
Ucn3	A	T	13: 3,941,474	F59L	probably benign	Het
Uggt1	A	G	1: 36,184,412	Y599H	probably damaging	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vav3	A	G	3: 109,527,475	M441V	possibly damaging	Het
Vmn2r1	T	A	3: 64,101,398	D499E	possibly damaging	Het
Vmn2r118	C	T	17: 55,611,565	G109D	probably benign	Het
Vmn2r5	T	A	3: 64,509,510	M76L	probably benign	Het
Vwa3a	A	G	7: 120,790,142	K68E	possibly damaging	Het
Zcchc6	A	T	13: 59,789,846		probably null	Het
Zmiz1	A	T	14: 25,649,813	Y459F	probably damaging	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1853:Stard9	UTSW	2	120688751	missense	probably damaging	1.00
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1907:Stard9	UTSW	2	120713812	missense	probably damaging	1.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4701:Stard9	UTSW	2	120705713	missense	possibly damaging	0.85
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5288:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6020:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6364:Stard9	UTSW	2	120713429	missense	probably damaging	1.00
R6383:Stard9	UTSW	2	120666407	critical splice donor site	probably null
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7375:Stard9	UTSW	2	120665002	splice site	probably null
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
R7761:Stard9	UTSW	2	120699379	missense	probably benign	0.00
R7794:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R7819:Stard9	UTSW	2	120700984	missense	probably damaging	1.00
R7823:Stard9	UTSW	2	120702106	missense	probably damaging	0.96
R7837:Stard9	UTSW	2	120703665	missense	probably benign	0.06
R7889:Stard9	UTSW	2	120704461	missense	probably benign	0.11
R7905:Stard9	UTSW	2	120696081	missense	not run
R7956:Stard9	UTSW	2	120705371	nonsense	probably null
R8013:Stard9	UTSW	2	120688101	missense	probably damaging	1.00
R8113:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8114:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8116:Stard9	UTSW	2	120664939	nonsense	probably null
R8117:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8118:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8170:Stard9	UTSW	2	120700048	missense	possibly damaging	0.76
R8300:Stard9	UTSW	2	120704769	missense	possibly damaging	0.71
R8333:Stard9	UTSW	2	120701789	missense	probably benign	0.00
R8337:Stard9	UTSW	2	120679825	missense	probably damaging	1.00
R8536:Stard9	UTSW	2	120714659	missense	possibly damaging	0.93
R8682:Stard9	UTSW	2	120703315	missense	possibly damaging	0.65
R8696:Stard9	UTSW	2	120701114	missense	probably benign	0.02
R8708:Stard9	UTSW	2	120703578	missense	probably damaging	1.00
R8732:Stard9	UTSW	2	120679961	missense	probably damaging	1.00
R8798:Stard9	UTSW	2	120704731	missense	probably benign	0.09
R8807:Stard9	UTSW	2	120705451	missense	probably damaging	1.00
R8807:Stard9	UTSW	2	120705462	missense	probably damaging	1.00
R8862:Stard9	UTSW	2	120703618	missense	probably benign
R8920:Stard9	UTSW	2	120702607	missense	probably damaging	0.96
R9026:Stard9	UTSW	2	120705802	missense	probably damaging	1.00
R9048:Stard9	UTSW	2	120677934	missense	probably damaging	0.99
R9049:Stard9	UTSW	2	120679937	missense	probably benign	0.30
R9152:Stard9	UTSW	2	120698587	missense	probably damaging	0.99
R9189:Stard9	UTSW	2	120703019	missense	possibly damaging	0.95
R9238:Stard9	UTSW	2	120697966	missense	probably damaging	1.00
R9372:Stard9	UTSW	2	120664939	nonsense	probably null
R9393:Stard9	UTSW	2	120688175	missense	possibly damaging	0.88
R9444:Stard9	UTSW	2	120664933	missense	probably damaging	1.00
R9514:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9515:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9516:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9570:Stard9	UTSW	2	120704233	missense	probably benign	0.02
R9649:Stard9	UTSW	2	120696154	missense	probably benign	0.20
R9789:Stard9	UTSW	2	120679936	missense	probably damaging	1.00
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92
Z1176:Stard9	UTSW	2	120695818	missense	probably benign	0.01
Z1176:Stard9	UTSW	2	120696612	missense	probably benign
Z1176:Stard9	UTSW	2	120698322	missense	probably damaging	1.00
Z1177:Stard9	UTSW	2	120673676	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GACTTCAGAGATACCTCCACAGG -3'
(R):5'- AAGTCTCATACGGAAGGACTGTC -3'

Sequencing Primer
(F):5'- GCTCAACTACCCAGGAAGCTTTG -3'
(R):5'- GCCACTAAGTCAGTAAGCTGCTTC -3'

Posted On

2016-08-04