Mutagenetix > Incidental Mutation

Incidental Mutation 'R0492:Prex2'

42505

Institutional Source

Beutler Lab

Gene Symbol

Prex2

Ensembl Gene

ENSMUSG00000048960

Gene Name

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2

Synonyms

C030045D06Rik, 6230420N16Rik, Depdc2

MMRRC Submission

038690-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.188) question?

Stock #

R0492 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10993465-11303681 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 11186633 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000027056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027056]

AlphaFold

Q3LAC4

Predicted Effect

probably benign
Transcript: ENSMUST00000027056

SMART Domains

Protein: ENSMUSP00000027056
Gene: ENSMUSG00000048960

Domain	Start	End	E-Value	Type
RhoGEF	19	205	8.61e-45	SMART
PH	238	355	2.43e-12	SMART
DEP	383	456	4.46e-26	SMART
DEP	484	557	6.57e-15	SMART
PDZ	593	666	9.62e-2	SMART
PDZ	677	744	6.37e-8	SMART
low complexity region	1112	1127	N/A	INTRINSIC
low complexity region	1498	1507	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

99% (99/100)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphatidylinositol 3,4,5-trisphosphate (PIP3)-dependent Rac exchanger (PREX) family, which are Dbl-type guanine-nucleotide exchange factors for Rac family small G proteins. Structural domains of this protein include the catalytic diffuse B-cell lymphoma homology and pleckstrin homology (DHPH) domain, two disheveled, EGL-10, and pleckstrin homology (DEP) domains, two PDZ domains, and a C-terminal inositol polyphosphate-4 phosphatase (IP4P) domain that is found in one of the isoforms. This protein facilitates the exchange of GDP for GTP on Rac1, allowing the GTP-bound Rac1 to activate downstream effectors. Studies also show that the pleckstrin homology domain of this protein interacts with the phosphatase and tensin homolog (PTEN) gene product to inhibit PTEN phosphatase activity, thus activating the phosphoinositide-3 kinase (PI3K) signaling pathway. Conversely, the PTEN gene product has also been shown to inhibit the GEF activity of this protein. This gene plays a role in insulin-signaling pathways, and either mutations or overexpression of this gene have been observed in some cancers. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for gene trapped alleles may exhibit abnormal Purkinje cell dendrite morphology, a mild motor coordination defect that progressively worsens with age, hypoactivity, impaired glucose tolerance and/or insulin resistance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 98 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931409K22Rik	A	T	5: 24,554,628	L48Q	probably damaging	Het
Adgrb2	C	G	4: 130,007,831	P416R	probably damaging	Het
Adgre1	A	G	17: 57,402,742	D133G	unknown	Het
AI314180	A	G	4: 58,864,418	W288R	probably damaging	Het
Alpl	A	C	4: 137,749,576		probably null	Het
Ankrd65	T	C	4: 155,790,676		probably benign	Het
Baalc	A	T	15: 38,934,085		probably benign	Het
Bpifb5	A	G	2: 154,228,900	T204A	probably benign	Het
Bud31	A	G	5: 145,146,455	Y77C	probably damaging	Het
Capsl	A	G	15: 9,461,844		probably benign	Het
Ccna1	A	G	3: 55,048,583	V116A	probably damaging	Het
Cdc42bpa	C	A	1: 180,101,190	H723N	probably benign	Het
Cfap161	T	C	7: 83,794,037	I40V	possibly damaging	Het
CK137956	C	T	4: 127,951,300	V217I	probably benign	Het
Cog5	A	G	12: 31,869,461	T540A	probably damaging	Het
Cps1	T	C	1: 67,157,836	W349R	probably damaging	Het
Crispld2	G	T	8: 120,026,067	V285L	probably benign	Het
Crtc2	T	A	3: 90,263,497	F626I	probably damaging	Het
Daam1	G	A	12: 71,944,380	R256H	unknown	Het
Dhx38	G	T	8: 109,561,944		probably benign	Het
Dok4	G	A	8: 94,865,136	A324V	probably benign	Het
Dscam	T	C	16: 96,825,782		probably null	Het
Dusp16	A	T	6: 134,718,402	S489T	probably benign	Het
Erbin	A	T	13: 103,834,358	Y917N	probably damaging	Het
F13b	A	T	1: 139,522,559		probably null	Het
Fam26f	G	A	10: 34,127,651	R87*	probably null	Het
Fdx1	C	A	9: 51,963,425	A15S	probably benign	Het
Ffar4	A	T	19: 38,097,182	Q19L	probably benign	Het
Folh1	A	C	7: 86,746,192	V344G	probably damaging	Het
Fscb	T	A	12: 64,473,518	E391D	possibly damaging	Het
Gigyf2	G	A	1: 87,440,846	G1083R	probably damaging	Het
Gm14403	C	A	2: 177,508,566	H102N	probably benign	Het
Gm4847	A	G	1: 166,630,392	F464S	probably damaging	Het
Gpam	A	T	19: 55,096,179	M56K	possibly damaging	Het
Gpr165	T	A	X: 96,717,172	F352I	probably damaging	Het
Grik2	T	G	10: 49,101,164	I891L	probably damaging	Het
Gsr	T	C	8: 33,681,575		probably benign	Het
Hhla1	A	G	15: 65,936,291	F302L	probably benign	Het
Impg1	T	C	9: 80,345,308	D453G	possibly damaging	Het
Inpp5d	T	A	1: 87,698,150	V495E	possibly damaging	Het
Iqce	A	T	5: 140,675,235	L450H	probably damaging	Het
Itfg2	A	G	6: 128,413,523		probably null	Het
Kif13a	A	G	13: 46,812,742	V400A	possibly damaging	Het
Kif7	T	C	7: 79,713,881	Y93C	probably damaging	Het
Krt33a	A	G	11: 100,016,083	V22A	probably benign	Het
Lct	T	C	1: 128,300,582	D1058G	probably damaging	Het
Lrp6	G	T	6: 134,480,518	D774E	possibly damaging	Het
Lrrc9	T	A	12: 72,478,763	S828R	possibly damaging	Het
Ly75	A	G	2: 60,308,276	W1416R	probably damaging	Het
Mdh2	T	C	5: 135,790,150	I320T	possibly damaging	Het
Med13l	T	A	5: 118,738,495	V912E	probably damaging	Het
Mgarp	T	C	3: 51,389,035	D182G	possibly damaging	Het
Mllt10	T	C	2: 18,146,887		probably benign	Het
Mmp28	G	A	11: 83,443,803	A375V	probably damaging	Het
Mrps23	T	A	11: 88,210,685	H133Q	probably benign	Het
Msh6	T	C	17: 87,975,251	S35P	probably benign	Het
Myo3a	A	G	2: 22,323,636	D347G	possibly damaging	Het
Npc1l1	T	C	11: 6,223,040	K800E	possibly damaging	Het
Olfr1034	T	C	2: 86,046,587	V35A	probably benign	Het
Olfr1034	T	C	2: 86,046,934	F151L	possibly damaging	Het
Olfr1086	G	A	2: 86,676,490	P281L	probably damaging	Het
Olfr152	T	G	2: 87,782,822	I94S	probably damaging	Het
Olfr414	T	A	1: 174,430,563	I45N	possibly damaging	Het
Olfr632	T	C	7: 103,937,764	I128T	probably benign	Het
Olfr695	A	T	7: 106,873,877	Y123N	probably damaging	Het
Osmr	A	C	15: 6,824,518	W570G	probably damaging	Het
Otol1	A	T	3: 70,027,784	I370F	probably damaging	Het
Pank2	A	G	2: 131,280,260	Y235C	probably damaging	Het
Pias2	T	C	18: 77,105,885	S187P	probably damaging	Het
Pkhd1l1	A	G	15: 44,519,690	N1115S	probably benign	Het
Pld1	G	T	3: 28,109,817	A800S	probably damaging	Het
Ptpn3	T	C	4: 57,194,304	Q908R	probably benign	Het
Rab3gap2	T	A	1: 185,252,392		probably benign	Het
Rbm24	A	T	13: 46,420,350	N82Y	probably damaging	Het
Rpl27	T	C	11: 101,445,255	V47A	possibly damaging	Het
Serpina1f	A	G	12: 103,693,567	V152A	possibly damaging	Het
Serpina5	A	G	12: 104,102,133	Y151C	probably damaging	Het
Serpinb7	A	G	1: 107,452,007	*381W	probably null	Het
Sh2b2	A	G	5: 136,232,263	F33S	probably damaging	Het
Slc22a2	A	C	17: 12,615,272	I476L	probably benign	Het
Slc6a12	A	T	6: 121,355,372	I222F	probably benign	Het
Smim26	G	A	2: 144,595,113	D61N	probably damaging	Het
Soat1	A	T	1: 156,441,354	Y209N	probably benign	Het
Sorl1	T	C	9: 41,991,371	H1630R	probably null	Het
Sptlc2	A	T	12: 87,346,806		probably null	Het
Strn3	G	A	12: 51,610,404	T642I	probably damaging	Het
Syce1l	T	A	8: 113,654,068	D137E	possibly damaging	Het
Syne2	T	C	12: 75,982,063		probably null	Het
Tcf25	C	A	8: 123,381,464	P86Q	probably benign	Het
Tmem19	A	T	10: 115,361,810	Y43*	probably null	Het
Tmem30b	T	C	12: 73,546,168	N58D	probably benign	Het
Tnn	A	C	1: 160,120,757	I795M	probably damaging	Het
Tnpo1	A	G	13: 98,855,446	Y641H	probably damaging	Het
Tra2a	A	T	6: 49,250,955		probably benign	Het
Trappc8	A	T	18: 20,866,186	F295I	probably benign	Het
Vmn2r101	T	A	17: 19,588,983	W125R	probably damaging	Het
Vps8	C	A	16: 21,442,357	F82L	probably damaging	Het
Ythdf2	A	T	4: 132,204,468	S460R	probably damaging	Het

Other mutations in Prex2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Prex2	APN	1	11186652	missense	possibly damaging	0.51
IGL00948:Prex2	APN	1	11170614	missense	probably damaging	0.98
IGL01087:Prex2	APN	1	11068104	missense	probably benign	0.00
IGL01490:Prex2	APN	1	11184545	splice site	probably null
IGL01533:Prex2	APN	1	11186741	nonsense	probably null
IGL01661:Prex2	APN	1	11208614	missense	probably benign	0.01
IGL01668:Prex2	APN	1	11153645	missense	probably benign	0.00
IGL01674:Prex2	APN	1	11170741	missense	probably damaging	1.00
IGL01716:Prex2	APN	1	11266054	missense	probably benign	0.04
IGL01867:Prex2	APN	1	11098503	missense	probably benign	0.11
IGL01954:Prex2	APN	1	11140011	missense	possibly damaging	0.75
IGL01990:Prex2	APN	1	11123233	splice site	probably benign
IGL02022:Prex2	APN	1	11297739	missense	probably benign	0.04
IGL02130:Prex2	APN	1	11112799	missense	probably damaging	1.00
IGL02130:Prex2	APN	1	11160162	missense	probably damaging	1.00
IGL02221:Prex2	APN	1	11061345	missense	probably benign	0.00
IGL02369:Prex2	APN	1	11101169	critical splice donor site	probably null
IGL02440:Prex2	APN	1	11153657	missense	possibly damaging	0.94
IGL02477:Prex2	APN	1	11204154	missense	probably benign
IGL02492:Prex2	APN	1	11123845	missense	possibly damaging	0.93
IGL03051:Prex2	APN	1	11142665	missense	probably damaging	1.00
IGL03154:Prex2	APN	1	11153633	missense	possibly damaging	0.63
IGL03158:Prex2	APN	1	11266067	missense	possibly damaging	0.89
IGL03308:Prex2	APN	1	11185175	missense	possibly damaging	0.89
IGL03338:Prex2	APN	1	11140265	missense	probably benign	0.01
R0042:Prex2	UTSW	1	11080081	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0052:Prex2	UTSW	1	11160156	missense	probably damaging	1.00
R0138:Prex2	UTSW	1	11285043	splice site	probably benign
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0206:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0208:Prex2	UTSW	1	11285144	missense	probably damaging	1.00
R0325:Prex2	UTSW	1	11200057	splice site	probably null
R0326:Prex2	UTSW	1	11285065	missense	probably damaging	1.00
R0390:Prex2	UTSW	1	11089706	splice site	probably null
R0512:Prex2	UTSW	1	11199933	missense	probably benign
R0515:Prex2	UTSW	1	11199874	missense	probably damaging	0.99
R0894:Prex2	UTSW	1	11181898	missense	probably benign
R1259:Prex2	UTSW	1	11289270	missense	probably damaging	1.00
R1332:Prex2	UTSW	1	11204091	missense	probably damaging	1.00
R1356:Prex2	UTSW	1	11080092	nonsense	probably null
R1451:Prex2	UTSW	1	11156259	missense	probably benign	0.01
R1488:Prex2	UTSW	1	11193528	missense	probably benign	0.05
R1512:Prex2	UTSW	1	11061330	missense	possibly damaging	0.64
R1641:Prex2	UTSW	1	11231772	missense	probably damaging	0.99
R1667:Prex2	UTSW	1	11186757	missense	probably benign
R1678:Prex2	UTSW	1	11285089	missense	possibly damaging	0.51
R1736:Prex2	UTSW	1	11089884	splice site	probably benign
R1781:Prex2	UTSW	1	11199955	missense	probably benign	0.17
R1804:Prex2	UTSW	1	11132342	missense	probably damaging	1.00
R1836:Prex2	UTSW	1	11136780	missense	probably damaging	1.00
R1899:Prex2	UTSW	1	11162366	nonsense	probably null
R1900:Prex2	UTSW	1	11162366	nonsense	probably null
R2020:Prex2	UTSW	1	11162312	missense	probably damaging	0.98
R2114:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2117:Prex2	UTSW	1	11186713	missense	probably damaging	1.00
R2436:Prex2	UTSW	1	11266152	missense	possibly damaging	0.90
R2902:Prex2	UTSW	1	11208614	missense	possibly damaging	0.77
R2915:Prex2	UTSW	1	11169853	missense	probably damaging	1.00
R2924:Prex2	UTSW	1	11098487	missense	probably damaging	1.00
R2981:Prex2	UTSW	1	11181962	missense	probably damaging	1.00
R3430:Prex2	UTSW	1	11149854	missense	possibly damaging	0.88
R3832:Prex2	UTSW	1	11156364	splice site	probably benign
R3870:Prex2	UTSW	1	11160192	missense	possibly damaging	0.86
R3963:Prex2	UTSW	1	11110357	missense	possibly damaging	0.93
R4012:Prex2	UTSW	1	11184516	missense	probably benign
R4030:Prex2	UTSW	1	11208568	missense	probably benign	0.06
R4214:Prex2	UTSW	1	11101159	missense	probably damaging	1.00
R4214:Prex2	UTSW	1	11285061	missense	probably damaging	1.00
R4242:Prex2	UTSW	1	11156304	missense	probably benign	0.06
R4490:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4491:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4492:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R4561:Prex2	UTSW	1	11184545	splice site	probably null
R4624:Prex2	UTSW	1	11289265	nonsense	probably null
R4647:Prex2	UTSW	1	11162285	missense	probably damaging	1.00
R4657:Prex2	UTSW	1	11065825	missense	probably benign	0.00
R4706:Prex2	UTSW	1	11199988	missense	probably damaging	1.00
R4806:Prex2	UTSW	1	11068020	missense	probably damaging	1.00
R4900:Prex2	UTSW	1	11149905	splice site	probably benign
R4922:Prex2	UTSW	1	11169940	missense	probably damaging	1.00
R4961:Prex2	UTSW	1	11098481	missense	possibly damaging	0.75
R5284:Prex2	UTSW	1	11266090	nonsense	probably null
R5305:Prex2	UTSW	1	11107678	missense	probably damaging	1.00
R5307:Prex2	UTSW	1	11200032	missense	probably damaging	0.99
R5331:Prex2	UTSW	1	11140011	missense	possibly damaging	0.75
R5385:Prex2	UTSW	1	11139980	missense	probably damaging	0.99
R5574:Prex2	UTSW	1	11140058	missense	probably damaging	1.00
R5979:Prex2	UTSW	1	11132372	missense	probably damaging	1.00
R6076:Prex2	UTSW	1	11185950	missense	probably benign	0.09
R6160:Prex2	UTSW	1	10993851	missense	probably damaging	1.00
R6177:Prex2	UTSW	1	11136777	missense	possibly damaging	0.49
R6221:Prex2	UTSW	1	11266012	missense	probably benign	0.01
R6293:Prex2	UTSW	1	11162298	missense	probably benign
R6335:Prex2	UTSW	1	11110320	missense	probably benign	0.13
R6401:Prex2	UTSW	1	11186727	missense	probably benign	0.00
R6427:Prex2	UTSW	1	11182031	missense	probably damaging	1.00
R6467:Prex2	UTSW	1	11266035	missense	probably damaging	1.00
R6564:Prex2	UTSW	1	11101061	splice site	probably null
R6734:Prex2	UTSW	1	11080059	missense	probably damaging	1.00
R6753:Prex2	UTSW	1	11184456	missense	probably damaging	0.98
R6880:Prex2	UTSW	1	11132384	missense	probably damaging	1.00
R6973:Prex2	UTSW	1	11112743	missense	probably damaging	1.00
R6980:Prex2	UTSW	1	11162263	missense	probably benign	0.05
R6987:Prex2	UTSW	1	11170752	missense	probably damaging	0.99
R7085:Prex2	UTSW	1	11098588	missense	possibly damaging	0.73
R7101:Prex2	UTSW	1	11153609	missense	possibly damaging	0.86
R7106:Prex2	UTSW	1	11136793	missense	probably benign	0.33
R7319:Prex2	UTSW	1	11162308	missense	probably benign	0.10
R7342:Prex2	UTSW	1	11162325	missense	probably benign	0.00
R7469:Prex2	UTSW	1	11285069	missense	probably damaging	1.00
R7528:Prex2	UTSW	1	11204092	missense	probably damaging	1.00
R7592:Prex2	UTSW	1	11123213	missense	probably damaging	1.00
R7650:Prex2	UTSW	1	11149854	missense	possibly damaging	0.67
R7695:Prex2	UTSW	1	11162273	missense	probably benign	0.00
R7720:Prex2	UTSW	1	11181937	missense	possibly damaging	0.47
R7733:Prex2	UTSW	1	11181959	missense	probably benign	0.31
R7859:Prex2	UTSW	1	11080050	missense	probably damaging	1.00
R8247:Prex2	UTSW	1	11199970	missense	probably benign
R8300:Prex2	UTSW	1	11231718	missense	possibly damaging	0.49
R8345:Prex2	UTSW	1	11199894	missense	possibly damaging	0.65
R8352:Prex2	UTSW	1	11285139	missense	probably benign
R8352:Prex2	UTSW	1	11285140	missense	probably benign
R8410:Prex2	UTSW	1	11153657	missense	possibly damaging	0.94
R8452:Prex2	UTSW	1	11285139	missense	probably benign
R8452:Prex2	UTSW	1	11285140	missense	probably benign
R8885:Prex2	UTSW	1	11170575	splice site	probably benign
R8926:Prex2	UTSW	1	11089706	splice site	probably null
R8968:Prex2	UTSW	1	11110338	nonsense	probably null
R9049:Prex2	UTSW	1	11185906	missense	probably damaging	0.98
R9398:Prex2	UTSW	1	11136804	missense	probably benign	0.00
R9452:Prex2	UTSW	1	11185927	missense	probably benign	0.01
R9549:Prex2	UTSW	1	11186691	missense	probably damaging	1.00
RF005:Prex2	UTSW	1	11185166	missense	possibly damaging	0.47
Z1177:Prex2	UTSW	1	11289252	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CAGCAGAGCAGCCTTCATAGATCTC -3'
(R):5'- GGTGCCACTGTATCCACGTTATCAC -3'

Sequencing Primer
(F):5'- AGTATTCACCATAGAGCTTCTGCG -3'
(R):5'- ACTGTATCCACGTTATCACAATGTTC -3'

Posted On

2013-05-23