Incidental Mutation 'R5385:Sorl1'
ID 425096
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms Sorla, mSorLA, LR11, 2900010L19Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R5385 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 41876016-42035593 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 41968580 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 558 (T558A)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect possibly damaging
Transcript: ENSMUST00000060989
AA Change: T558A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: T558A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a T C 10: 80,421,446 (GRCm39) T175A probably benign Het
Adam23 A G 1: 63,590,970 (GRCm39) D479G possibly damaging Het
Adgrl3 T G 5: 81,874,648 (GRCm39) Y1050D probably damaging Het
Ago4 A G 4: 126,411,349 (GRCm39) I103T probably benign Het
Ajuba T C 14: 54,807,855 (GRCm39) Y459C probably damaging Het
Aldh7a1 T A 18: 56,667,325 (GRCm39) N316Y possibly damaging Het
Alyref2 A G 1: 171,331,271 (GRCm39) N16S probably benign Het
Ankhd1 A G 18: 36,724,548 (GRCm39) E402G probably damaging Het
Ankrd36 A G 11: 5,639,340 (GRCm39) probably benign Het
Ap2b1 T C 11: 83,233,427 (GRCm39) V480A probably damaging Het
Arhgap30 A G 1: 171,235,848 (GRCm39) R741G probably benign Het
Canx A G 11: 50,192,639 (GRCm39) L325P probably damaging Het
Ccpg1 G A 9: 72,920,326 (GRCm39) S647N probably benign Het
Cdc37l1 T G 19: 28,989,343 (GRCm39) S267A possibly damaging Het
Cert1 A G 13: 96,765,575 (GRCm39) T447A possibly damaging Het
Ces1f A T 8: 93,992,388 (GRCm39) C354* probably null Het
Cpne1 A T 2: 155,916,284 (GRCm39) V350D probably damaging Het
Ctdsp2 A G 10: 126,832,326 (GRCm39) T262A probably benign Het
Cypt4 A G 9: 24,536,596 (GRCm39) K29E possibly damaging Het
Dlg2 T C 7: 91,737,784 (GRCm39) V422A probably damaging Het
Dmxl2 A G 9: 54,286,041 (GRCm39) S2715P probably benign Het
Dnah3 T A 7: 119,524,126 (GRCm39) K3953N probably damaging Het
Dnmt1 A G 9: 20,829,776 (GRCm39) V647A probably damaging Het
Duox2 A G 2: 122,125,617 (GRCm39) V330A probably benign Het
Dusp8 T A 7: 141,643,730 (GRCm39) Q61L possibly damaging Het
Dync2h1 T C 9: 7,016,791 (GRCm39) D3573G probably damaging Het
Ears2 G C 7: 121,643,600 (GRCm39) T426S probably benign Het
Ext1 C A 15: 52,939,213 (GRCm39) W612L probably damaging Het
Fam91a1 G A 15: 58,320,243 (GRCm39) S645N probably benign Het
Fat3 A T 9: 15,833,971 (GRCm39) L4207Q possibly damaging Het
Fbxo38 A G 18: 62,674,042 (GRCm39) M13T probably benign Het
Fbxo48 G T 11: 16,904,329 (GRCm39) L160F possibly damaging Het
Fer1l4 G A 2: 155,879,286 (GRCm39) Q906* probably null Het
Fpr2 C A 17: 18,113,309 (GRCm39) H102N probably benign Het
Gm10134 T A 2: 28,396,372 (GRCm39) probably benign Het
Gpr107 A G 2: 31,104,263 (GRCm39) T523A probably benign Het
Grin3a G A 4: 49,719,313 (GRCm39) P811L probably damaging Het
Hivep1 A T 13: 42,317,871 (GRCm39) probably null Het
Hmcn2 A G 2: 31,350,333 (GRCm39) T5077A probably benign Het
Hpse C T 5: 100,856,590 (GRCm39) W136* probably null Het
Ifitm3 T C 7: 140,590,554 (GRCm39) N2S probably benign Het
Ifnar2 T A 16: 91,201,086 (GRCm39) D442E possibly damaging Het
Jade1 T A 3: 41,546,137 (GRCm39) I54N probably damaging Het
Jag1 A T 2: 136,937,464 (GRCm39) H303Q possibly damaging Het
Kcnh4 T C 11: 100,643,076 (GRCm39) D397G probably damaging Het
Kcnj1 A G 9: 32,308,019 (GRCm39) R148G probably damaging Het
Lct T G 1: 128,239,354 (GRCm39) K277N possibly damaging Het
Loxl3 A G 6: 83,027,593 (GRCm39) M712V probably damaging Het
Ly75 A G 2: 60,133,985 (GRCm39) C1547R probably damaging Het
Marcks A G 10: 37,014,453 (GRCm39) S27P probably damaging Het
Mef2c A G 13: 83,810,532 (GRCm39) T347A probably benign Het
Mmp3 C T 9: 7,451,759 (GRCm39) R366* probably null Het
Mrgprx2 T C 7: 48,132,753 (GRCm39) T22A probably benign Het
Msc C A 1: 14,825,644 (GRCm39) R110L probably damaging Het
Mtcl3 A G 10: 29,072,766 (GRCm39) D686G probably benign Het
Myh11 A T 16: 14,025,872 (GRCm39) V1366D possibly damaging Het
Ncf1 A G 5: 134,250,659 (GRCm39) L373P probably damaging Het
Neb A T 2: 52,079,873 (GRCm39) I85N probably damaging Het
Nfkb1 A G 3: 135,318,303 (GRCm39) V310A possibly damaging Het
Nop2 T C 6: 125,121,324 (GRCm39) V702A probably benign Het
Nudt12 A G 17: 59,310,434 (GRCm39) W390R probably damaging Het
Or10ag53 C T 2: 87,082,827 (GRCm39) P182L probably benign Het
Or10v9 T A 19: 11,832,541 (GRCm39) I259F probably damaging Het
Or11g24 T A 14: 50,662,846 (GRCm39) V290E possibly damaging Het
Or1af1 G T 2: 37,109,599 (GRCm39) A33S possibly damaging Het
Or51e1 T C 7: 102,358,553 (GRCm39) L29P probably damaging Het
Or6c208 A G 10: 129,223,633 (GRCm39) I44V probably benign Het
Or6n2 A T 1: 173,897,036 (GRCm39) K57N probably benign Het
Or8a1b A T 9: 37,623,317 (GRCm39) V86E probably damaging Het
Or8c11 A T 9: 38,289,281 (GRCm39) I29F probably benign Het
Or8g2b A G 9: 39,751,126 (GRCm39) Y132C possibly damaging Het
Otub2 G A 12: 103,359,055 (GRCm39) probably benign Het
Pck2 A G 14: 55,782,688 (GRCm39) E339G probably damaging Het
Pdcd7 G A 9: 65,265,974 (GRCm39) W477* probably null Het
Pdpk1 G A 17: 24,317,114 (GRCm39) Q250* probably null Het
Pigb T A 9: 72,946,827 (GRCm39) H16L probably benign Het
Pitpnm1 T C 19: 4,153,435 (GRCm39) F197S probably damaging Het
Plekhh2 T C 17: 84,864,894 (GRCm39) V94A probably benign Het
Pnpla7 C A 2: 24,931,031 (GRCm39) P882Q probably damaging Het
Pold2 A G 11: 5,826,760 (GRCm39) L58P probably damaging Het
Pomt1 C G 2: 32,134,311 (GRCm39) Y277* probably null Het
Prex2 A G 1: 11,210,204 (GRCm39) D548G probably damaging Het
Prkra T G 2: 76,469,622 (GRCm39) T146P probably damaging Het
Prss51 T A 14: 64,334,543 (GRCm39) V108E probably damaging Het
Rai2 A G X: 160,561,636 (GRCm39) N363S probably benign Het
Ranbp17 A T 11: 33,169,241 (GRCm39) V991D possibly damaging Het
Riox2 T A 16: 59,306,979 (GRCm39) M290K probably benign Het
Rnpepl1 T A 1: 92,844,914 (GRCm39) L402Q probably damaging Het
S1pr2 T C 9: 20,878,890 (GRCm39) T313A probably benign Het
Sesn2 A G 4: 132,226,575 (GRCm39) I173T probably damaging Het
Setx T G 2: 29,024,045 (GRCm39) probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,103,382 (GRCm39) probably benign Het
Sgsm3 T C 15: 80,892,200 (GRCm39) V256A probably benign Het
Shroom4 T A X: 6,497,523 (GRCm39) C894* probably null Het
Slc13a5 T A 11: 72,149,903 (GRCm39) E159D probably benign Het
Slc16a7 A G 10: 125,130,473 (GRCm39) Y71H possibly damaging Het
Slc28a2b C A 2: 122,353,259 (GRCm39) L480I probably benign Het
Slc4a7 T C 14: 14,773,345 (GRCm38) F772L possibly damaging Het
Snapc4 A G 2: 26,264,515 (GRCm39) S275P probably benign Het
Sspo C T 6: 48,439,187 (GRCm39) P1612S probably benign Het
Stard9 A G 2: 120,531,111 (GRCm39) E2456G probably damaging Het
Stx1b A T 7: 127,414,575 (GRCm39) D16E probably benign Het
Supv3l1 A T 10: 62,266,375 (GRCm39) N600K possibly damaging Het
Syne1 C T 10: 4,991,494 (GRCm39) V557I probably benign Het
Tanc2 T A 11: 105,667,672 (GRCm39) D84E probably damaging Het
Tep1 A T 14: 51,105,774 (GRCm39) L82Q probably damaging Het
Tfip11 T C 5: 112,479,086 (GRCm39) probably null Het
Thtpa G T 14: 55,333,290 (GRCm39) R125L probably damaging Het
Tm9sf1 C T 14: 55,880,301 (GRCm39) G32D possibly damaging Het
Tmcc3 A T 10: 94,415,015 (GRCm39) N239I probably damaging Het
Tpd52 A T 3: 8,996,255 (GRCm39) probably null Het
Traf6 T A 2: 101,515,100 (GRCm39) C85* probably null Het
Trim68 T G 7: 102,327,990 (GRCm39) D321A probably damaging Het
Trmt6 C A 2: 132,650,703 (GRCm39) A302S probably benign Het
Ttbk1 T C 17: 46,758,558 (GRCm39) D692G probably benign Het
Ttc17 A T 2: 94,133,985 (GRCm39) W1067R probably damaging Het
Ttc6 T A 12: 57,689,821 (GRCm39) probably null Het
Tut7 A T 13: 59,937,660 (GRCm39) probably null Het
Txnrd2 T G 16: 18,296,442 (GRCm39) I468S probably damaging Het
Ube2b A T 11: 51,879,471 (GRCm39) Y100N probably damaging Het
Ucn3 A T 13: 3,991,474 (GRCm39) F59L probably benign Het
Uggt1 A G 1: 36,223,493 (GRCm39) Y599H probably damaging Het
Ulk3 T A 9: 57,498,023 (GRCm39) I108N possibly damaging Het
Vav3 A G 3: 109,434,791 (GRCm39) M441V possibly damaging Het
Vmn2r1 T A 3: 64,008,819 (GRCm39) D499E possibly damaging Het
Vmn2r118 C T 17: 55,918,565 (GRCm39) G109D probably benign Het
Vmn2r5 T A 3: 64,416,931 (GRCm39) M76L probably benign Het
Vwa3a A G 7: 120,389,365 (GRCm39) K68E possibly damaging Het
Zmiz1 A T 14: 25,650,237 (GRCm39) Y459F probably damaging Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41,885,390 (GRCm39) missense probably damaging 1.00
IGL01303:Sorl1 APN 9 41,935,774 (GRCm39) splice site probably benign
IGL01545:Sorl1 APN 9 41,955,252 (GRCm39) missense probably damaging 1.00
IGL01629:Sorl1 APN 9 41,968,565 (GRCm39) critical splice donor site probably null
IGL01670:Sorl1 APN 9 41,912,788 (GRCm39) missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41,892,007 (GRCm39) missense probably damaging 0.96
IGL02154:Sorl1 APN 9 41,915,330 (GRCm39) missense probably benign
IGL02215:Sorl1 APN 9 41,929,478 (GRCm39) missense probably damaging 0.97
IGL02427:Sorl1 APN 9 41,952,986 (GRCm39) missense probably damaging 1.00
IGL02590:Sorl1 APN 9 41,957,857 (GRCm39) missense probably benign 0.01
IGL02794:Sorl1 APN 9 41,975,070 (GRCm39) missense probably damaging 0.98
IGL02797:Sorl1 APN 9 41,948,355 (GRCm39) missense probably damaging 0.99
IGL02987:Sorl1 APN 9 41,952,349 (GRCm39) missense probably damaging 1.00
IGL03005:Sorl1 APN 9 41,968,621 (GRCm39) missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41,902,722 (GRCm39) missense probably benign
IGL03288:Sorl1 APN 9 41,944,858 (GRCm39) splice site probably benign
N/A - 287:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
PIT4151001:Sorl1 UTSW 9 41,879,918 (GRCm39) missense probably damaging 1.00
R0117:Sorl1 UTSW 9 41,944,873 (GRCm39) missense probably benign 0.10
R0173:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R0318:Sorl1 UTSW 9 41,993,250 (GRCm39) missense probably damaging 1.00
R0385:Sorl1 UTSW 9 41,943,205 (GRCm39) missense probably damaging 0.99
R0448:Sorl1 UTSW 9 41,915,384 (GRCm39) missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41,902,667 (GRCm39) missense probably null 0.00
R0512:Sorl1 UTSW 9 41,979,128 (GRCm39) missense probably benign 0.01
R0587:Sorl1 UTSW 9 41,895,802 (GRCm39) missense probably damaging 1.00
R0600:Sorl1 UTSW 9 41,955,196 (GRCm39) splice site probably benign
R0831:Sorl1 UTSW 9 41,982,365 (GRCm39) splice site probably benign
R0924:Sorl1 UTSW 9 41,919,470 (GRCm39) splice site probably benign
R1013:Sorl1 UTSW 9 41,913,855 (GRCm39) missense probably benign 0.00
R1053:Sorl1 UTSW 9 41,902,752 (GRCm39) missense probably benign
R1077:Sorl1 UTSW 9 41,925,786 (GRCm39) missense probably damaging 1.00
R1326:Sorl1 UTSW 9 41,943,092 (GRCm39) missense probably benign 0.14
R1348:Sorl1 UTSW 9 41,911,708 (GRCm39) splice site probably null
R1498:Sorl1 UTSW 9 41,952,369 (GRCm39) missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41,885,296 (GRCm39) missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41,907,538 (GRCm39) missense probably benign 0.06
R1738:Sorl1 UTSW 9 42,001,261 (GRCm39) missense probably benign 0.33
R1779:Sorl1 UTSW 9 41,902,778 (GRCm39) critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41,881,021 (GRCm39) nonsense probably null
R1912:Sorl1 UTSW 9 41,993,246 (GRCm39) missense probably damaging 1.00
R1952:Sorl1 UTSW 9 41,957,920 (GRCm39) missense probably benign
R2071:Sorl1 UTSW 9 41,890,753 (GRCm39) missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41,895,788 (GRCm39) missense probably benign 0.01
R2417:Sorl1 UTSW 9 41,892,007 (GRCm39) missense probably damaging 0.96
R2429:Sorl1 UTSW 9 41,948,366 (GRCm39) missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41,881,077 (GRCm39) missense probably benign
R3815:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 41,915,401 (GRCm39) missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41,900,764 (GRCm39) critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 41,946,744 (GRCm39) missense probably damaging 0.99
R4410:Sorl1 UTSW 9 41,915,288 (GRCm39) nonsense probably null
R4610:Sorl1 UTSW 9 41,943,210 (GRCm39) missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4666:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41,895,804 (GRCm39) missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41,903,617 (GRCm39) missense probably damaging 1.00
R4874:Sorl1 UTSW 9 41,975,048 (GRCm39) missense probably damaging 0.99
R4898:Sorl1 UTSW 9 41,952,935 (GRCm39) missense probably damaging 1.00
R4922:Sorl1 UTSW 9 41,925,746 (GRCm39) splice site probably null
R4976:Sorl1 UTSW 9 41,894,299 (GRCm39) missense probably benign 0.00
R4984:Sorl1 UTSW 9 41,902,638 (GRCm39) missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R5070:Sorl1 UTSW 9 41,943,114 (GRCm39) missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41,887,673 (GRCm39) missense probably benign 0.01
R5202:Sorl1 UTSW 9 41,944,879 (GRCm39) missense probably benign 0.00
R5265:Sorl1 UTSW 9 42,017,812 (GRCm39) missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 41,942,198 (GRCm39) missense probably benign 0.33
R5368:Sorl1 UTSW 9 41,890,686 (GRCm39) missense probably benign 0.00
R5386:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 41,913,932 (GRCm39) nonsense probably null
R5518:Sorl1 UTSW 9 41,948,508 (GRCm39) missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41,902,921 (GRCm39) missense probably benign 0.08
R5864:Sorl1 UTSW 9 42,003,669 (GRCm39) missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41,894,330 (GRCm39) missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41,881,038 (GRCm39) missense probably benign 0.10
R6484:Sorl1 UTSW 9 41,887,703 (GRCm39) missense probably damaging 1.00
R6505:Sorl1 UTSW 9 41,982,530 (GRCm39) missense probably damaging 1.00
R6591:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6596:Sorl1 UTSW 9 41,912,899 (GRCm39) missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41,891,941 (GRCm39) missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6702:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6703:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42,003,748 (GRCm39) missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42,010,559 (GRCm39) missense probably damaging 1.00
R6852:Sorl1 UTSW 9 41,935,694 (GRCm39) missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 41,933,688 (GRCm39) missense probably benign 0.01
R6925:Sorl1 UTSW 9 41,944,922 (GRCm39) missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41,881,047 (GRCm39) missense probably benign 0.11
R7033:Sorl1 UTSW 9 41,942,279 (GRCm39) missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 41,913,930 (GRCm39) missense probably benign 0.00
R7267:Sorl1 UTSW 9 42,035,375 (GRCm39) missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 41,948,499 (GRCm39) missense probably damaging 0.99
R7272:Sorl1 UTSW 9 41,975,006 (GRCm39) splice site probably null
R7537:Sorl1 UTSW 9 41,891,984 (GRCm39) missense probably benign 0.01
R7615:Sorl1 UTSW 9 41,888,878 (GRCm39) missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42,003,630 (GRCm39) missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41,895,822 (GRCm39) missense probably damaging 1.00
R7763:Sorl1 UTSW 9 41,955,205 (GRCm39) missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42,001,257 (GRCm39) missense probably benign 0.17
R7956:Sorl1 UTSW 9 41,900,655 (GRCm39) missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41,902,697 (GRCm39) missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R8151:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R8219:Sorl1 UTSW 9 41,952,857 (GRCm39) splice site probably null
R8261:Sorl1 UTSW 9 41,925,777 (GRCm39) missense probably damaging 1.00
R8283:Sorl1 UTSW 9 41,942,294 (GRCm39) missense probably damaging 1.00
R8308:Sorl1 UTSW 9 41,929,456 (GRCm39) missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8448:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8524:Sorl1 UTSW 9 41,885,370 (GRCm39) missense probably damaging 1.00
R8869:Sorl1 UTSW 9 41,933,722 (GRCm39) missense probably benign 0.01
R8898:Sorl1 UTSW 9 41,911,567 (GRCm39) missense probably damaging 1.00
R8972:Sorl1 UTSW 9 41,957,848 (GRCm39) missense probably damaging 1.00
R9012:Sorl1 UTSW 9 41,982,491 (GRCm39) missense probably damaging 1.00
R9094:Sorl1 UTSW 9 41,975,050 (GRCm39) missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41,885,420 (GRCm39) nonsense probably null
R9278:Sorl1 UTSW 9 41,957,857 (GRCm39) missense probably benign 0.01
R9288:Sorl1 UTSW 9 41,952,927 (GRCm39) missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41,900,739 (GRCm39) missense probably damaging 1.00
R9330:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 1.00
R9332:Sorl1 UTSW 9 41,912,814 (GRCm39) missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42,035,384 (GRCm39) missense probably benign 0.20
R9528:Sorl1 UTSW 9 41,933,631 (GRCm39) critical splice donor site probably null
R9544:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9563:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9564:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9588:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9634:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R9671:Sorl1 UTSW 9 41,943,077 (GRCm39) missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42,003,766 (GRCm39) missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42,035,244 (GRCm39) missense probably benign 0.03
Z1176:Sorl1 UTSW 9 42,010,499 (GRCm39) missense possibly damaging 0.64
Z1177:Sorl1 UTSW 9 42,017,837 (GRCm39) missense probably benign 0.00
Z1177:Sorl1 UTSW 9 41,902,934 (GRCm39) missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42,035,208 (GRCm39) missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGACGACACCAGTGTGAG -3'
(R):5'- GTTCTGAGAACTGGAAGCTGTC -3'

Sequencing Primer
(F):5'- GCGGGATTGGCAAATTCTACACC -3'
(R):5'- AAGCTGTCCTTGGGGTGG -3'
Posted On 2016-08-04