Mutagenetix > Incidental Mutation

Incidental Mutation 'R5385:Sorl1'

425096

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R5385 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42057284 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 558 (T558A)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

possibly damaging
Transcript: ENSMUST00000060989
AA Change: T558A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: T558A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 129 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17a	T	C	10: 80,585,612	T175A	probably benign	Het
Adam23	A	G	1: 63,551,811	D479G	possibly damaging	Het
Adgrl3	T	G	5: 81,726,801	Y1050D	probably damaging	Het
Ago4	A	G	4: 126,517,556	I103T	probably benign	Het
Ajuba	T	C	14: 54,570,398	Y459C	probably damaging	Het
Aldh7a1	T	A	18: 56,534,253	N316Y	possibly damaging	Het
Alyref2	A	G	1: 171,503,703	N16S	probably benign	Het
Ankhd1	A	G	18: 36,591,495	E402G	probably damaging	Het
Ankrd36	A	G	11: 5,689,340		probably benign	Het
Ap2b1	T	C	11: 83,342,601	V480A	probably damaging	Het
Arhgap30	A	G	1: 171,408,280	R741G	probably benign	Het
Canx	A	G	11: 50,301,812	L325P	probably damaging	Het
Ccpg1	G	A	9: 73,013,044	S647N	probably benign	Het
Cdc37l1	T	G	19: 29,011,943	S267A	possibly damaging	Het
Ces1f	A	T	8: 93,265,760	C354*	probably null	Het
Col4a3bp	A	G	13: 96,629,067	T447A	possibly damaging	Het
Cpne1	A	T	2: 156,074,364	V350D	probably damaging	Het
Ctdsp2	A	G	10: 126,996,457	T262A	probably benign	Het
Cypt4	A	G	9: 24,625,300	K29E	possibly damaging	Het
Dlg2	T	C	7: 92,088,576	V422A	probably damaging	Het
Dmxl2	A	G	9: 54,378,757	S2715P	probably benign	Het
Dnah3	T	A	7: 119,924,903	K3953N	probably damaging	Het
Dnmt1	A	G	9: 20,918,480	V647A	probably damaging	Het
Duox2	A	G	2: 122,295,136	V330A	probably benign	Het
Dusp8	T	A	7: 142,089,993	Q61L	possibly damaging	Het
Dync2h1	T	C	9: 7,016,791	D3573G	probably damaging	Het
Ears2	G	C	7: 122,044,377	T426S	probably benign	Het
Ext1	C	A	15: 53,075,817	W612L	probably damaging	Het
Fam91a1	G	A	15: 58,448,394	S645N	probably benign	Het
Fat3	A	T	9: 15,922,675	L4207Q	possibly damaging	Het
Fbxo38	A	G	18: 62,540,971	M13T	probably benign	Het
Fbxo48	G	T	11: 16,954,329	L160F	possibly damaging	Het
Fer1l4	G	A	2: 156,037,366	Q906*	probably null	Het
Fpr2	C	A	17: 17,893,047	H102N	probably benign	Het
Gm10134	T	A	2: 28,506,360		probably benign	Het
Gm14085	C	A	2: 122,522,778	L480I	probably benign	Het
Gpr107	A	G	2: 31,214,251	T523A	probably benign	Het
Grin3a	G	A	4: 49,719,313	P811L	probably damaging	Het
Hivep1	A	T	13: 42,164,395		probably null	Het
Hmcn2	A	G	2: 31,460,321	T5077A	probably benign	Het
Hpse	C	T	5: 100,708,724	W136*	probably null	Het
Ifitm3	T	C	7: 141,010,641	N2S	probably benign	Het
Ifnar2	T	A	16: 91,404,198	D442E	possibly damaging	Het
Jade1	T	A	3: 41,591,702	I54N	probably damaging	Het
Jag1	A	T	2: 137,095,544	H303Q	possibly damaging	Het
Kcnh4	T	C	11: 100,752,250	D397G	probably damaging	Het
Kcnj1	A	G	9: 32,396,723	R148G	probably damaging	Het
Lct	T	G	1: 128,311,617	K277N	possibly damaging	Het
Loxl3	A	G	6: 83,050,612	M712V	probably damaging	Het
Ly75	A	G	2: 60,303,641	C1547R	probably damaging	Het
Marcks	A	G	10: 37,138,457	S27P	probably damaging	Het
Mef2c	A	G	13: 83,662,413	T347A	probably benign	Het
Mmp3	C	T	9: 7,451,759	R366*	probably null	Het
Mrgprx2	T	C	7: 48,483,005	T22A	probably benign	Het
Msc	C	A	1: 14,755,420	R110L	probably damaging	Het
Myh11	A	T	16: 14,208,008	V1366D	possibly damaging	Het
Ncf1	A	G	5: 134,221,805	L373P	probably damaging	Het
Neb	A	T	2: 52,189,861	I85N	probably damaging	Het
Nfkb1	A	G	3: 135,612,542	V310A	possibly damaging	Het
Nop2	T	C	6: 125,144,361	V702A	probably benign	Het
Nudt12	A	G	17: 59,003,439	W390R	probably damaging	Het
Olfr1115	C	T	2: 87,252,483	P182L	probably benign	Het
Olfr1418	T	A	19: 11,855,177	I259F	probably damaging	Het
Olfr160	A	T	9: 37,712,021	V86E	probably damaging	Het
Olfr251	A	T	9: 38,377,985	I29F	probably benign	Het
Olfr366	G	T	2: 37,219,587	A33S	possibly damaging	Het
Olfr430	A	T	1: 174,069,470	K57N	probably benign	Het
Olfr558	T	C	7: 102,709,346	L29P	probably damaging	Het
Olfr739	T	A	14: 50,425,389	V290E	possibly damaging	Het
Olfr784	A	G	10: 129,387,764	I44V	probably benign	Het
Olfr971	A	G	9: 39,839,830	Y132C	possibly damaging	Het
Otub2	G	A	12: 103,392,796		probably benign	Het
Pck2	A	G	14: 55,545,231	E339G	probably damaging	Het
Pdcd7	G	A	9: 65,358,692	W477*	probably null	Het
Pdpk1	G	A	17: 24,098,140	Q250*	probably null	Het
Pigb	T	A	9: 73,039,545	H16L	probably benign	Het
Pitpnm1	T	C	19: 4,103,435	F197S	probably damaging	Het
Plekhh2	T	C	17: 84,557,466	V94A	probably benign	Het
Pnpla7	C	A	2: 25,041,019	P882Q	probably damaging	Het
Pold2	A	G	11: 5,876,760	L58P	probably damaging	Het
Pomt1	C	G	2: 32,244,299	Y277*	probably null	Het
Prex2	A	G	1: 11,139,980	D548G	probably damaging	Het
Prkra	T	G	2: 76,639,278	T146P	probably damaging	Het
Prss51	T	A	14: 64,097,094	V108E	probably damaging	Het
Rai2	A	G	X: 161,778,640	N363S	probably benign	Het
Ranbp17	A	T	11: 33,219,241	V991D	possibly damaging	Het
Riox2	T	A	16: 59,486,616	M290K	probably benign	Het
Rnpepl1	T	A	1: 92,917,192	L402Q	probably damaging	Het
S1pr2	T	C	9: 20,967,594	T313A	probably benign	Het
Sesn2	A	G	4: 132,499,264	I173T	probably damaging	Het
Setx	T	G	2: 29,134,033		probably null	Het
Sfi1	ACA	ACATCTTCCCAAAGCCAGTCA	11: 3,153,382		probably benign	Het
Sgsm3	T	C	15: 81,007,999	V256A	probably benign	Het
Shroom4	T	A	X: 6,585,469	C894*	probably null	Het
Slc13a5	T	A	11: 72,259,077	E159D	probably benign	Het
Slc16a7	A	G	10: 125,294,604	Y71H	possibly damaging	Het
Slc4a7	T	C	14: 14,773,345	F772L	possibly damaging	Het
Snapc4	A	G	2: 26,374,503	S275P	probably benign	Het
Soga3	A	G	10: 29,196,770	D686G	probably benign	Het
Sspo	C	T	6: 48,462,253	P1612S	probably benign	Het
Stard9	A	G	2: 120,700,630	E2456G	probably damaging	Het
Stx1b	A	T	7: 127,815,403	D16E	probably benign	Het
Supv3l1	A	T	10: 62,430,596	N600K	possibly damaging	Het
Syne1	C	T	10: 5,041,494	V557I	probably benign	Het
Tanc2	T	A	11: 105,776,846	D84E	probably damaging	Het
Tep1	A	T	14: 50,868,317	L82Q	probably damaging	Het
Tfip11	T	C	5: 112,331,220		probably null	Het
Thtpa	G	T	14: 55,095,833	R125L	probably damaging	Het
Tm9sf1	C	T	14: 55,642,844	G32D	possibly damaging	Het
Tmcc3	A	T	10: 94,579,153	N239I	probably damaging	Het
Tpd52	A	T	3: 8,931,195		probably null	Het
Traf6	T	A	2: 101,684,755	C85*	probably null	Het
Trim68	T	G	7: 102,678,783	D321A	probably damaging	Het
Trmt6	C	A	2: 132,808,783	A302S	probably benign	Het
Ttbk1	T	C	17: 46,447,632	D692G	probably benign	Het
Ttc17	A	T	2: 94,303,640	W1067R	probably damaging	Het
Ttc6	T	A	12: 57,643,035		probably null	Het
Txnrd2	T	G	16: 18,477,692	I468S	probably damaging	Het
Ube2b	A	T	11: 51,988,644	Y100N	probably damaging	Het
Ucn3	A	T	13: 3,941,474	F59L	probably benign	Het
Uggt1	A	G	1: 36,184,412	Y599H	probably damaging	Het
Ulk3	T	A	9: 57,590,740	I108N	possibly damaging	Het
Vav3	A	G	3: 109,527,475	M441V	possibly damaging	Het
Vmn2r1	T	A	3: 64,101,398	D499E	possibly damaging	Het
Vmn2r118	C	T	17: 55,611,565	G109D	probably benign	Het
Vmn2r5	T	A	3: 64,509,510	M76L	probably benign	Het
Vwa3a	A	G	7: 120,790,142	K68E	possibly damaging	Het
Zcchc6	A	T	13: 59,789,846		probably null	Het
Zmiz1	A	T	14: 25,649,813	Y459F	probably damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGACGACACCAGTGTGAG -3'
(R):5'- GTTCTGAGAACTGGAAGCTGTC -3'

Sequencing Primer
(F):5'- GCGGGATTGGCAAATTCTACACC -3'
(R):5'- AAGCTGTCCTTGGGGTGG -3'

Posted On

2016-08-04