Incidental Mutation 'R5385:Ankhd1'
Institutional Source Beutler Lab
Gene Symbol Ankhd1
Ensembl Gene ENSMUSG00000024483
Gene Nameankyrin repeat and KH domain containing 1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5385 (G1)
Quality Score225
Status Not validated
Chromosomal Location36559987-36665917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36591495 bp
Amino Acid Change Glutamic Acid to Glycine at position 402 (E402G)
Ref Sequence ENSEMBL: ENSMUSP00000120290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006205] [ENSMUST00000142977] [ENSMUST00000155329]
Predicted Effect probably damaging
Transcript: ENSMUST00000006205
AA Change: E402G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000006205
Gene: ENSMUSG00000024483
AA Change: E402G

low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000142977
AA Change: E402G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120290
Gene: ENSMUSG00000024483
AA Change: E402G

low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2334 2346 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000155329
AA Change: E402G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123270
Gene: ENSMUSG00000024483
AA Change: E402G

low complexity region 20 38 N/A INTRINSIC
low complexity region 48 78 N/A INTRINSIC
low complexity region 91 109 N/A INTRINSIC
ANK 207 236 2.11e2 SMART
ANK 240 269 3.31e-1 SMART
ANK 274 303 5.24e-4 SMART
ANK 307 336 7.64e-6 SMART
ANK 340 369 2.7e-6 SMART
ANK 374 403 3.23e-4 SMART
ANK 407 436 1.61e-4 SMART
ANK 440 469 5.16e-3 SMART
ANK 473 502 4.16e-7 SMART
ANK 507 536 1.68e-2 SMART
ANK 537 566 7.02e-5 SMART
ANK 570 599 7.95e-4 SMART
ANK 603 632 4.56e-4 SMART
ANK 637 666 9.64e-3 SMART
ANK 670 699 6.71e-2 SMART
coiled coil region 815 855 N/A INTRINSIC
ANK 1057 1086 2.07e-2 SMART
ANK 1090 1119 2.48e-5 SMART
ANK 1124 1153 3.85e-2 SMART
ANK 1157 1186 1.61e-4 SMART
ANK 1192 1221 1.24e-5 SMART
ANK 1226 1255 1.59e-3 SMART
ANK 1259 1288 3.91e-3 SMART
ANK 1294 1323 5.93e-3 SMART
ANK 1327 1356 9.41e-6 SMART
ANK 1360 1393 3.8e-1 SMART
coiled coil region 1422 1486 N/A INTRINSIC
low complexity region 1509 1526 N/A INTRINSIC
low complexity region 1538 1557 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
KH 1693 1763 5.04e-13 SMART
low complexity region 1968 2001 N/A INTRINSIC
low complexity region 2041 2057 N/A INTRINSIC
low complexity region 2064 2081 N/A INTRINSIC
low complexity region 2342 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 129 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17a T C 10: 80,585,612 T175A probably benign Het
Adam23 A G 1: 63,551,811 D479G possibly damaging Het
Adgrl3 T G 5: 81,726,801 Y1050D probably damaging Het
Ago4 A G 4: 126,517,556 I103T probably benign Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Aldh7a1 T A 18: 56,534,253 N316Y possibly damaging Het
Alyref2 A G 1: 171,503,703 N16S probably benign Het
Ankrd36 A G 11: 5,689,340 probably benign Het
Ap2b1 T C 11: 83,342,601 V480A probably damaging Het
Arhgap30 A G 1: 171,408,280 R741G probably benign Het
Canx A G 11: 50,301,812 L325P probably damaging Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdc37l1 T G 19: 29,011,943 S267A possibly damaging Het
Ces1f A T 8: 93,265,760 C354* probably null Het
Col4a3bp A G 13: 96,629,067 T447A possibly damaging Het
Cpne1 A T 2: 156,074,364 V350D probably damaging Het
Ctdsp2 A G 10: 126,996,457 T262A probably benign Het
Cypt4 A G 9: 24,625,300 K29E possibly damaging Het
Dlg2 T C 7: 92,088,576 V422A probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah3 T A 7: 119,924,903 K3953N probably damaging Het
Dnmt1 A G 9: 20,918,480 V647A probably damaging Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Dync2h1 T C 9: 7,016,791 D3573G probably damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Ext1 C A 15: 53,075,817 W612L probably damaging Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fat3 A T 9: 15,922,675 L4207Q possibly damaging Het
Fbxo38 A G 18: 62,540,971 M13T probably benign Het
Fbxo48 G T 11: 16,954,329 L160F possibly damaging Het
Fer1l4 G A 2: 156,037,366 Q906* probably null Het
Fpr2 C A 17: 17,893,047 H102N probably benign Het
Gm10134 T A 2: 28,506,360 probably benign Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gpr107 A G 2: 31,214,251 T523A probably benign Het
Grin3a G A 4: 49,719,313 P811L probably damaging Het
Hivep1 A T 13: 42,164,395 probably null Het
Hmcn2 A G 2: 31,460,321 T5077A probably benign Het
Hpse C T 5: 100,708,724 W136* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Ifnar2 T A 16: 91,404,198 D442E possibly damaging Het
Jade1 T A 3: 41,591,702 I54N probably damaging Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh4 T C 11: 100,752,250 D397G probably damaging Het
Kcnj1 A G 9: 32,396,723 R148G probably damaging Het
Lct T G 1: 128,311,617 K277N possibly damaging Het
Loxl3 A G 6: 83,050,612 M712V probably damaging Het
Ly75 A G 2: 60,303,641 C1547R probably damaging Het
Marcks A G 10: 37,138,457 S27P probably damaging Het
Mef2c A G 13: 83,662,413 T347A probably benign Het
Mmp3 C T 9: 7,451,759 R366* probably null Het
Mrgprx2 T C 7: 48,483,005 T22A probably benign Het
Msc C A 1: 14,755,420 R110L probably damaging Het
Myh11 A T 16: 14,208,008 V1366D possibly damaging Het
Ncf1 A G 5: 134,221,805 L373P probably damaging Het
Neb A T 2: 52,189,861 I85N probably damaging Het
Nfkb1 A G 3: 135,612,542 V310A possibly damaging Het
Nop2 T C 6: 125,144,361 V702A probably benign Het
Nudt12 A G 17: 59,003,439 W390R probably damaging Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1418 T A 19: 11,855,177 I259F probably damaging Het
Olfr160 A T 9: 37,712,021 V86E probably damaging Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr366 G T 2: 37,219,587 A33S possibly damaging Het
Olfr430 A T 1: 174,069,470 K57N probably benign Het
Olfr558 T C 7: 102,709,346 L29P probably damaging Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr784 A G 10: 129,387,764 I44V probably benign Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Otub2 G A 12: 103,392,796 probably benign Het
Pck2 A G 14: 55,545,231 E339G probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pdpk1 G A 17: 24,098,140 Q250* probably null Het
Pigb T A 9: 73,039,545 H16L probably benign Het
Pitpnm1 T C 19: 4,103,435 F197S probably damaging Het
Plekhh2 T C 17: 84,557,466 V94A probably benign Het
Pnpla7 C A 2: 25,041,019 P882Q probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Pomt1 C G 2: 32,244,299 Y277* probably null Het
Prex2 A G 1: 11,139,980 D548G probably damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Rai2 A G X: 161,778,640 N363S probably benign Het
Ranbp17 A T 11: 33,219,241 V991D possibly damaging Het
Riox2 T A 16: 59,486,616 M290K probably benign Het
Rnpepl1 T A 1: 92,917,192 L402Q probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Sesn2 A G 4: 132,499,264 I173T probably damaging Het
Setx T G 2: 29,134,033 probably null Het
Sfi1 ACA ACATCTTCCCAAAGCCAGTCA 11: 3,153,382 probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc13a5 T A 11: 72,259,077 E159D probably benign Het
Slc16a7 A G 10: 125,294,604 Y71H possibly damaging Het
Slc4a7 T C 14: 14,773,345 F772L possibly damaging Het
Snapc4 A G 2: 26,374,503 S275P probably benign Het
Soga3 A G 10: 29,196,770 D686G probably benign Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Sspo C T 6: 48,462,253 P1612S probably benign Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Supv3l1 A T 10: 62,430,596 N600K possibly damaging Het
Syne1 C T 10: 5,041,494 V557I probably benign Het
Tanc2 T A 11: 105,776,846 D84E probably damaging Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tfip11 T C 5: 112,331,220 probably null Het
Thtpa G T 14: 55,095,833 R125L probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmcc3 A T 10: 94,579,153 N239I probably damaging Het
Tpd52 A T 3: 8,931,195 probably null Het
Traf6 T A 2: 101,684,755 C85* probably null Het
Trim68 T G 7: 102,678,783 D321A probably damaging Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttbk1 T C 17: 46,447,632 D692G probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Ttc6 T A 12: 57,643,035 probably null Het
Txnrd2 T G 16: 18,477,692 I468S probably damaging Het
Ube2b A T 11: 51,988,644 Y100N probably damaging Het
Ucn3 A T 13: 3,941,474 F59L probably benign Het
Uggt1 A G 1: 36,184,412 Y599H probably damaging Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vav3 A G 3: 109,527,475 M441V possibly damaging Het
Vmn2r1 T A 3: 64,101,398 D499E possibly damaging Het
Vmn2r118 C T 17: 55,611,565 G109D probably benign Het
Vmn2r5 T A 3: 64,509,510 M76L probably benign Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zcchc6 A T 13: 59,789,846 probably null Het
Zmiz1 A T 14: 25,649,813 Y459F probably damaging Het
Other mutations in Ankhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Ankhd1 APN 18 36665459 unclassified probably benign
IGL00927:Ankhd1 APN 18 36632072 missense probably benign 0.01
IGL01367:Ankhd1 APN 18 36578643 missense probably benign 0.16
IGL01624:Ankhd1 APN 18 36658013 missense probably damaging 1.00
IGL01725:Ankhd1 APN 18 36648153 missense probably benign 0.04
IGL01767:Ankhd1 APN 18 36648374 missense probably damaging 1.00
IGL02005:Ankhd1 APN 18 36648426 missense probably damaging 1.00
IGL02009:Ankhd1 APN 18 36624661 missense probably damaging 1.00
IGL02246:Ankhd1 APN 18 36656726 missense probably damaging 1.00
IGL02336:Ankhd1 APN 18 36594814 missense probably damaging 0.97
IGL02628:Ankhd1 APN 18 36647703 missense probably benign 0.00
IGL02644:Ankhd1 APN 18 36578775 critical splice donor site probably null
IGL02735:Ankhd1 APN 18 36648546 missense probably benign 0.00
IGL02877:Ankhd1 APN 18 36594823 missense probably damaging 1.00
IGL03129:Ankhd1 APN 18 36658008 nonsense probably null
IGL03163:Ankhd1 APN 18 36647628 missense probably damaging 0.97
IGL03182:Ankhd1 APN 18 36578774 missense probably benign 0.06
IGL03184:Ankhd1 APN 18 36647777 missense probably damaging 1.00
IGL03398:Ankhd1 APN 18 36656837 splice site probably benign
FR4304:Ankhd1 UTSW 18 36560924 small insertion probably benign
R0051:Ankhd1 UTSW 18 36647188 unclassified probably benign
R0089:Ankhd1 UTSW 18 36640356 missense probably damaging 0.99
R0105:Ankhd1 UTSW 18 36646766 missense probably damaging 1.00
R0149:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0243:Ankhd1 UTSW 18 36634734 missense probably damaging 1.00
R0322:Ankhd1 UTSW 18 36658008 nonsense probably null
R0361:Ankhd1 UTSW 18 36647214 missense probably damaging 1.00
R0389:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0418:Ankhd1 UTSW 18 36634300 missense probably damaging 1.00
R0443:Ankhd1 UTSW 18 36644599 missense possibly damaging 0.48
R0540:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0607:Ankhd1 UTSW 18 36640280 missense probably damaging 1.00
R0738:Ankhd1 UTSW 18 36645249 splice site probably benign
R1127:Ankhd1 UTSW 18 36634346 missense probably damaging 1.00
R1434:Ankhd1 UTSW 18 36625159 missense probably benign 0.09
R1742:Ankhd1 UTSW 18 36625265 missense probably damaging 1.00
R1776:Ankhd1 UTSW 18 36647308 missense probably benign 0.17
R1856:Ankhd1 UTSW 18 36644527 missense probably benign 0.00
R1923:Ankhd1 UTSW 18 36648030 missense probably benign 0.08
R2044:Ankhd1 UTSW 18 36645113 missense probably benign 0.31
R2112:Ankhd1 UTSW 18 36641626 missense probably damaging 1.00
R2115:Ankhd1 UTSW 18 36634308 missense probably damaging 1.00
R2136:Ankhd1 UTSW 18 36647621 missense probably benign
R2196:Ankhd1 UTSW 18 36648379 missense probably damaging 1.00
R2291:Ankhd1 UTSW 18 36644333 missense probably benign 0.31
R2305:Ankhd1 UTSW 18 36642926 missense possibly damaging 0.59
R2309:Ankhd1 UTSW 18 36624765 missense probably damaging 1.00
R2519:Ankhd1 UTSW 18 36578543 intron probably null
R2958:Ankhd1 UTSW 18 36634729 missense probably damaging 1.00
R3978:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R3980:Ankhd1 UTSW 18 36647613 missense probably damaging 0.96
R4159:Ankhd1 UTSW 18 36589540 missense possibly damaging 0.91
R4199:Ankhd1 UTSW 18 36661048 unclassified probably benign
R4323:Ankhd1 UTSW 18 36578633 missense probably damaging 1.00
R4356:Ankhd1 UTSW 18 36643043 nonsense probably null
R4496:Ankhd1 UTSW 18 36560786 missense probably damaging 0.98
R4551:Ankhd1 UTSW 18 36655507 unclassified probably null
R4590:Ankhd1 UTSW 18 36583644 missense probably damaging 1.00
R4667:Ankhd1 UTSW 18 36648021 missense possibly damaging 0.77
R4889:Ankhd1 UTSW 18 36578734 missense probably null 0.00
R4923:Ankhd1 UTSW 18 36589452 missense probably damaging 1.00
R5091:Ankhd1 UTSW 18 36625027 missense possibly damaging 0.68
R5254:Ankhd1 UTSW 18 36656715 missense probably benign 0.05
R5314:Ankhd1 UTSW 18 36561058 splice site probably null
R5336:Ankhd1 UTSW 18 36646716 missense probably damaging 1.00
R5367:Ankhd1 UTSW 18 36589408 missense probably damaging 1.00
R5384:Ankhd1 UTSW 18 36591495 missense probably damaging 1.00
R5387:Ankhd1 UTSW 18 36634644 missense probably damaging 1.00
R5458:Ankhd1 UTSW 18 36648485 missense probably benign 0.01
R5599:Ankhd1 UTSW 18 36560807 missense probably damaging 0.98
R5659:Ankhd1 UTSW 18 36561050 missense probably damaging 1.00
R5750:Ankhd1 UTSW 18 36624902 missense probably benign 0.00
R5874:Ankhd1 UTSW 18 36640269 missense possibly damaging 0.92
R5894:Ankhd1 UTSW 18 36647524 missense probably damaging 0.99
R5969:Ankhd1 UTSW 18 36600834 missense probably damaging 1.00
R6133:Ankhd1 UTSW 18 36625126 missense possibly damaging 0.77
R6190:Ankhd1 UTSW 18 36611809 missense possibly damaging 0.84
R6247:Ankhd1 UTSW 18 36654146 missense probably benign 0.00
R6512:Ankhd1 UTSW 18 36591456 missense probably damaging 1.00
R6649:Ankhd1 UTSW 18 36600783 unclassified probably null
R6653:Ankhd1 UTSW 18 36600783 unclassified probably null
R6763:Ankhd1 UTSW 18 36642969 missense probably benign 0.31
R6976:Ankhd1 UTSW 18 36648254 missense probably benign 0.00
R7075:Ankhd1 UTSW 18 36559989 missense
R7208:Ankhd1 UTSW 18 36625028 missense probably benign
R7305:Ankhd1 UTSW 18 36632205 missense
R7615:Ankhd1 UTSW 18 36656773 missense
R7654:Ankhd1 UTSW 18 36594101 missense probably damaging 1.00
R7781:Ankhd1 UTSW 18 36625205 missense probably damaging 1.00
R7842:Ankhd1 UTSW 18 36647828 missense probably benign 0.00
R7925:Ankhd1 UTSW 18 36647828 missense probably benign 0.00
R8006:Ankhd1 UTSW 18 36648719 missense
R8037:Ankhd1 UTSW 18 36638623 missense probably damaging 0.98
RF001:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF004:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF007:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF008:Ankhd1 UTSW 18 36560924 small insertion probably benign
RF009:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF013:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF016:Ankhd1 UTSW 18 36560910 small insertion probably benign
RF017:Ankhd1 UTSW 18 36560909 small insertion probably benign
RF018:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF026:Ankhd1 UTSW 18 36560912 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560913 small insertion probably benign
RF030:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF039:Ankhd1 UTSW 18 36560918 small insertion probably benign
RF043:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF046:Ankhd1 UTSW 18 36560926 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560917 small insertion probably benign
RF047:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF049:Ankhd1 UTSW 18 36560923 small insertion probably benign
RF050:Ankhd1 UTSW 18 36560927 small insertion probably benign
RF054:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF057:Ankhd1 UTSW 18 36560929 small insertion probably benign
RF060:Ankhd1 UTSW 18 36560922 small insertion probably benign
RF061:Ankhd1 UTSW 18 36560921 small insertion probably benign
RF062:Ankhd1 UTSW 18 36560918 small insertion probably benign
X0027:Ankhd1 UTSW 18 36624832 missense probably damaging 1.00
X0065:Ankhd1 UTSW 18 36578764 nonsense probably null
X0066:Ankhd1 UTSW 18 36646704 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-08-04