Incidental Mutation 'R5386:Hoxd11'
ID 425172
Institutional Source Beutler Lab
Gene Symbol Hoxd11
Ensembl Gene ENSMUSG00000042499
Gene Name homeobox D11
Synonyms Hox-5.4, Hox-4.6, E230017H14Rik, Hox-5.5
Accession Numbers
Essential gene? Probably essential (E-score: 0.757) question?
Stock # R5386 (G1)
Quality Score 92
Status Not validated
Chromosome 2
Chromosomal Location 74679557-74687016 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 74682819 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 143 (E143*)
Ref Sequence ENSEMBL: ENSMUSP00000122582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000142312]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000048086
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136302
Predicted Effect probably null
Transcript: ENSMUST00000142312
AA Change: E143*
SMART Domains Protein: ENSMUSP00000122582
Gene: ENSMUSG00000042499
AA Change: E143*

DomainStartEndE-ValueType
Pfam:DUF3528 26 80 5.4e-25 PFAM
Pfam:DUF3528 103 198 7.1e-21 PFAM
low complexity region 224 257 N/A INTRINSIC
HOX 264 326 1.58e-24 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the homeobox family of genes. The homeobox genes encode a highly conserved family of transcription factors that play an important role in morphogenesis in all multicellular organisms. Mammals possess four similar homeobox gene clusters, HOXA, HOXB, HOXC and HOXD, located on different chromosomes, consisting of 9 to 11 genes arranged in tandem. This gene is one of several homeobox HOXD genes located in a cluster on chromosome 2. Deletions that remove the entire HOXD gene cluster or the 5' end of this cluster have been associated with severe limb and genital abnormalities. The product of the mouse Hoxd11 gene plays a role in forelimb morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit homeotic transformations of sacral vertebrae, malformations of distal limbs, and reduced fertility in males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,194,413 G887R probably damaging Het
4931406P16Rik A G 7: 34,242,388 F120L probably damaging Het
Abcc12 T G 8: 86,517,489 K1012Q possibly damaging Het
Afmid G A 11: 117,828,142 G33R probably benign Het
Agbl3 G T 6: 34,799,196 W207C probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Ak2 T C 4: 129,008,172 S213P probably benign Het
Alk T A 17: 71,875,012 N1339Y probably damaging Het
Angpt1 T C 15: 42,438,365 S416G probably damaging Het
Ank2 C T 3: 126,981,933 V854M probably benign Het
Ankrd61 G T 5: 143,891,664 N122K possibly damaging Het
Armc9 T A 1: 86,198,289 L34Q probably null Het
Aspg T A 12: 112,123,032 V418E probably benign Het
Baz1b C T 5: 135,238,059 R1241C probably damaging Het
Bclaf1 T C 10: 20,325,592 V201A possibly damaging Het
C1ql3 A T 2: 13,004,358 D225E probably damaging Het
Capn9 A G 8: 124,605,540 T417A possibly damaging Het
Card14 C T 11: 119,317,289 R62C probably damaging Het
Cc2d2a A G 5: 43,730,041 N1271S probably benign Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdv3 T C 9: 103,355,230 K133R possibly damaging Het
Cep128 A C 12: 90,999,571 S1087R probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Chit1 T G 1: 134,149,454 F332V probably damaging Het
Chodl C A 16: 78,946,697 T219K probably damaging Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyp3a59 A G 5: 146,085,768 Y28C probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dedd T C 1: 171,338,383 L23P probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah9 T C 11: 66,029,356 N2237S probably damaging Het
Drosha A G 15: 12,842,121 I337V probably benign Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Elmo1 T C 13: 20,600,210 Y646H probably benign Het
Eps15 T A 4: 109,321,225 I220K possibly damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fam213b T A 4: 154,899,005 M1L probably benign Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fancg G A 4: 43,007,076 Q234* probably null Het
Gid4 T A 11: 60,432,442 probably null Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gm7361 A C 5: 26,258,905 T53P probably benign Het
Golgb1 T A 16: 36,912,315 C641* probably null Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gpr156 T A 16: 37,948,309 V64E possibly damaging Het
Grid2 T A 6: 63,931,105 I243K probably damaging Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac5 T C 11: 102,202,141 E590G possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hif1a A G 12: 73,944,093 E713G probably benign Het
Hmx3 A G 7: 131,544,304 D247G probably damaging Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Il17f T C 1: 20,777,957 Q99R probably benign Het
Itga6 T A 2: 71,841,150 S341R probably damaging Het
Itgam A G 7: 128,107,980 N661S probably benign Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh8 T A 17: 52,725,995 N103K probably benign Het
Kdm6b T C 11: 69,400,810 probably benign Het
Keg1 A C 19: 12,714,538 N63T probably damaging Het
Klf12 T A 14: 99,900,159 H317L probably damaging Het
Lrp1 A T 10: 127,592,114 V530E probably damaging Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myo1a G T 10: 127,705,897 E102* probably null Het
Napa A T 7: 16,116,472 E265D probably benign Het
Ncam1 A C 9: 49,564,874 V305G probably damaging Het
Nek8 T C 11: 78,170,437 probably null Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1242 G T 2: 89,494,137 Y58* probably null Het
Olfr1275 T C 2: 111,231,194 T200A probably benign Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Olfr987 T C 2: 85,331,635 T88A probably benign Het
Pabpc4 A G 4: 123,294,997 Q417R probably benign Het
Panx3 A T 9: 37,669,024 M11K probably damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pi4k2a G A 19: 42,090,515 S5N probably damaging Het
Plag1 T A 4: 3,904,075 Q372L probably benign Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld4 G T 12: 112,763,988 E102* probably null Het
Pnlip A G 19: 58,679,607 N345S probably benign Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Ptch1 A G 13: 63,545,043 Y181H probably damaging Het
Reln A G 5: 22,039,529 V817A probably benign Het
Rictor C A 15: 6,789,504 Q1403K probably benign Het
Rims1 T A 1: 22,412,245 I882F probably damaging Het
Rnf19a A G 15: 36,242,039 V618A probably benign Het
Ryr1 A T 7: 29,117,416 I65N probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Serpine2 A T 1: 79,821,287 Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc14a2 T A 18: 78,185,840 D306V possibly damaging Het
Slc4a10 A T 2: 62,290,058 E843V probably damaging Het
Smyd4 T A 11: 75,390,156 C152S probably damaging Het
Snx10 T C 6: 51,575,972 Y32H probably damaging Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Spata31d1b G A 13: 59,719,052 C1338Y possibly damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tecpr2 T C 12: 110,915,453 V152A probably damaging Het
Tedc1 T C 12: 113,156,682 V47A probably benign Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmco2 A G 4: 121,105,984 L106P probably damaging Het
Tmem131 A T 1: 36,872,558 C103S possibly damaging Het
Tmprss7 T A 16: 45,669,528 I444F possibly damaging Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Ttc17 A T 2: 94,303,640 W1067R probably damaging Het
Tulp4 T A 17: 6,236,293 V1532D probably damaging Het
Ubqlnl T G 7: 104,149,217 I358L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vps13b A T 15: 35,640,528 probably null Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zfp746 G T 6: 48,064,176 H538N possibly damaging Het
Other mutations in Hoxd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00550:Hoxd11 APN 2 74684041 missense probably damaging 1.00
R1202:Hoxd11 UTSW 2 74682577 missense possibly damaging 0.92
R3895:Hoxd11 UTSW 2 74682792 missense probably damaging 0.99
R3935:Hoxd11 UTSW 2 74684032 missense probably benign 0.28
R7322:Hoxd11 UTSW 2 74684011 missense probably damaging 1.00
R7476:Hoxd11 UTSW 2 74684115 missense probably damaging 0.96
R8060:Hoxd11 UTSW 2 74682376 start gained probably benign
R8188:Hoxd11 UTSW 2 74683954 missense probably damaging 1.00
R8315:Hoxd11 UTSW 2 74683122 missense probably benign 0.00
R8697:Hoxd11 UTSW 2 74682669 missense unknown
R8875:Hoxd11 UTSW 2 74683021 missense probably benign 0.00
R9093:Hoxd11 UTSW 2 74684138 makesense probably null
R9102:Hoxd11 UTSW 2 74682930 missense possibly damaging 0.93
R9570:Hoxd11 UTSW 2 74682468 missense possibly damaging 0.86
Z1177:Hoxd11 UTSW 2 74682415 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGATGACTTTCCCCTAC -3'
(R):5'- AGTAGCACATAAAACGGCGC -3'

Sequencing Primer
(F):5'- AGGTGGCCTTTCGCGACTAC -3'
(R):5'- CTTGGGGTCGCCCTTGTC -3'
Posted On 2016-08-04