Incidental Mutation 'R5386:Ttc17'
ID425177
Institutional Source Beutler Lab
Gene Symbol Ttc17
Ensembl Gene ENSMUSG00000027194
Gene Nametetratricopeptide repeat domain 17
SynonymsD2Bwg1005e, 9130020K17Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R5386 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location94300767-94406689 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 94303640 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 1067 (W1067R)
Ref Sequence ENSEMBL: ENSMUSP00000106868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055081] [ENSMUST00000111237] [ENSMUST00000111238]
Predicted Effect probably damaging
Transcript: ENSMUST00000055081
AA Change: W551R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000061360
Gene: ENSMUSG00000027194
AA Change: W551R

DomainStartEndE-ValueType
TPR 46 79 1.33e1 SMART
Blast:TPR 82 115 3e-10 BLAST
TPR 116 149 4.91e-4 SMART
low complexity region 326 344 N/A INTRINSIC
TPR 499 532 2.43e1 SMART
TPR 535 568 6.75e1 SMART
TPR 569 602 6.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111237
AA Change: W1067R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194
AA Change: W1067R

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Blast:TPR 225 258 8e-11 BLAST
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 842 860 N/A INTRINSIC
TPR 1015 1048 2.43e1 SMART
TPR 1051 1084 6.75e1 SMART
TPR 1085 1118 6.84e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111238
AA Change: W1124R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: W1124R

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
internal_repeat_2 113 271 8.31e-15 PROSPERO
low complexity region 275 293 N/A INTRINSIC
TPR 295 328 1.39e-3 SMART
coiled coil region 340 382 N/A INTRINSIC
TPR 619 652 1.33e1 SMART
Blast:TPR 655 688 4e-10 BLAST
TPR 689 722 4.91e-4 SMART
low complexity region 899 917 N/A INTRINSIC
TPR 1072 1105 2.43e1 SMART
TPR 1108 1141 6.75e1 SMART
TPR 1142 1175 6.84e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G A 15: 8,194,413 G887R probably damaging Het
4931406P16Rik A G 7: 34,242,388 F120L probably damaging Het
Abcc12 T G 8: 86,517,489 K1012Q possibly damaging Het
Afmid G A 11: 117,828,142 G33R probably benign Het
Agbl3 G T 6: 34,799,196 W207C probably damaging Het
Ajuba T C 14: 54,570,398 Y459C probably damaging Het
Ak2 T C 4: 129,008,172 S213P probably benign Het
Alk T A 17: 71,875,012 N1339Y probably damaging Het
Angpt1 T C 15: 42,438,365 S416G probably damaging Het
Ank2 C T 3: 126,981,933 V854M probably benign Het
Ankrd61 G T 5: 143,891,664 N122K possibly damaging Het
Armc9 T A 1: 86,198,289 L34Q probably null Het
Aspg T A 12: 112,123,032 V418E probably benign Het
Baz1b C T 5: 135,238,059 R1241C probably damaging Het
Bclaf1 T C 10: 20,325,592 V201A possibly damaging Het
C1ql3 A T 2: 13,004,358 D225E probably damaging Het
Capn9 A G 8: 124,605,540 T417A possibly damaging Het
Card14 C T 11: 119,317,289 R62C probably damaging Het
Cc2d2a A G 5: 43,730,041 N1271S probably benign Het
Ccpg1 G A 9: 73,013,044 S647N probably benign Het
Cdv3 T C 9: 103,355,230 K133R possibly damaging Het
Cep128 A C 12: 90,999,571 S1087R probably benign Het
Cep70 T A 9: 99,281,075 L325Q probably damaging Het
Chit1 T G 1: 134,149,454 F332V probably damaging Het
Chodl C A 16: 78,946,697 T219K probably damaging Het
Cntn4 T C 6: 106,181,804 L10P possibly damaging Het
Copg1 G T 6: 87,890,207 M87I possibly damaging Het
Cyp3a59 A G 5: 146,085,768 Y28C probably benign Het
Dchs1 A C 7: 105,758,029 V2119G probably damaging Het
Dedd T C 1: 171,338,383 L23P probably damaging Het
Dmxl2 A G 9: 54,378,757 S2715P probably benign Het
Dnah9 T C 11: 66,029,356 N2237S probably damaging Het
Drosha A G 15: 12,842,121 I337V probably benign Het
Duox2 A G 2: 122,295,136 V330A probably benign Het
Dusp11 T C 6: 85,947,605 *322W probably null Het
Dusp8 T A 7: 142,089,993 Q61L possibly damaging Het
Ears2 G C 7: 122,044,377 T426S probably benign Het
Elmo1 T C 13: 20,600,210 Y646H probably benign Het
Eps15 T A 4: 109,321,225 I220K possibly damaging Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Fam171a2 C A 11: 102,437,867 V689L possibly damaging Het
Fam213b T A 4: 154,899,005 M1L probably benign Het
Fam91a1 G A 15: 58,448,394 S645N probably benign Het
Fancg G A 4: 43,007,076 Q234* probably null Het
Gid4 T A 11: 60,432,442 probably null Het
Gm14085 C A 2: 122,522,778 L480I probably benign Het
Gm7361 A C 5: 26,258,905 T53P probably benign Het
Golgb1 T A 16: 36,912,315 C641* probably null Het
Gon4l T A 3: 88,858,496 M409K probably benign Het
Gpatch8 A T 11: 102,508,227 probably null Het
Gpr156 T A 16: 37,948,309 V64E possibly damaging Het
Grid2 T A 6: 63,931,105 I243K probably damaging Het
Gucy2g G A 19: 55,215,116 A750V probably damaging Het
Hdac5 T C 11: 102,202,141 E590G possibly damaging Het
Herc3 T A 6: 58,874,278 M504K probably damaging Het
Hif1a A G 12: 73,944,093 E713G probably benign Het
Hmx3 A G 7: 131,544,304 D247G probably damaging Het
Hoxd11 G T 2: 74,682,819 E143* probably null Het
Ifitm3 T C 7: 141,010,641 N2S probably benign Het
Il17f T C 1: 20,777,957 Q99R probably benign Het
Itga6 T A 2: 71,841,150 S341R probably damaging Het
Itgam A G 7: 128,107,980 N661S probably benign Het
Jag1 A T 2: 137,095,544 H303Q possibly damaging Het
Kcnh8 T A 17: 52,725,995 N103K probably benign Het
Kdm6b T C 11: 69,400,810 probably benign Het
Keg1 A C 19: 12,714,538 N63T probably damaging Het
Klf12 T A 14: 99,900,159 H317L probably damaging Het
Lrp1 A T 10: 127,592,114 V530E probably damaging Het
Mrgpra6 A G 7: 47,188,881 C190R probably damaging Het
Myo1a G T 10: 127,705,897 E102* probably null Het
Napa A T 7: 16,116,472 E265D probably benign Het
Ncam1 A C 9: 49,564,874 V305G probably damaging Het
Nek8 T C 11: 78,170,437 probably null Het
Olfr1115 C T 2: 87,252,483 P182L probably benign Het
Olfr1242 G T 2: 89,494,137 Y58* probably null Het
Olfr1275 T C 2: 111,231,194 T200A probably benign Het
Olfr191 T A 16: 59,085,890 M198L probably benign Het
Olfr243 T C 7: 103,717,355 F254L probably benign Het
Olfr251 A T 9: 38,377,985 I29F probably benign Het
Olfr739 T A 14: 50,425,389 V290E possibly damaging Het
Olfr971 A G 9: 39,839,830 Y132C possibly damaging Het
Olfr987 T C 2: 85,331,635 T88A probably benign Het
Pabpc4 A G 4: 123,294,997 Q417R probably benign Het
Panx3 A T 9: 37,669,024 M11K probably damaging Het
Pcbp1 C T 6: 86,525,489 E143K probably damaging Het
Pdcd7 G A 9: 65,358,692 W477* probably null Het
Pi4k2a G A 19: 42,090,515 S5N probably damaging Het
Plag1 T A 4: 3,904,075 Q372L probably benign Het
Plce1 C A 19: 38,760,091 N1755K probably damaging Het
Pld4 G T 12: 112,763,988 E102* probably null Het
Pnlip A G 19: 58,679,607 N345S probably benign Het
Ppm1e A T 11: 87,358,551 L118Q possibly damaging Het
Prkra T G 2: 76,639,278 T146P probably damaging Het
Prpf8 A G 11: 75,495,799 D1038G probably damaging Het
Prss51 T A 14: 64,097,094 V108E probably damaging Het
Ptch1 A G 13: 63,545,043 Y181H probably damaging Het
Reln A G 5: 22,039,529 V817A probably benign Het
Rictor C A 15: 6,789,504 Q1403K probably benign Het
Rims1 T A 1: 22,412,245 I882F probably damaging Het
Rnf19a A G 15: 36,242,039 V618A probably benign Het
Ryr1 A T 7: 29,117,416 I65N probably damaging Het
S1pr2 T C 9: 20,967,594 T313A probably benign Het
Serpine2 A T 1: 79,821,287 Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Het
Sgip1 T C 4: 102,915,059 V215A probably benign Het
Sgsm3 T C 15: 81,007,999 V256A probably benign Het
Shroom4 T A X: 6,585,469 C894* probably null Het
Slc14a2 T A 18: 78,185,840 D306V possibly damaging Het
Slc4a10 A T 2: 62,290,058 E843V probably damaging Het
Smyd4 T A 11: 75,390,156 C152S probably damaging Het
Snx10 T C 6: 51,575,972 Y32H probably damaging Het
Sorl1 T C 9: 42,057,284 T558A possibly damaging Het
Spata31d1b G A 13: 59,719,052 C1338Y possibly damaging Het
Sppl2c T A 11: 104,187,301 I309K possibly damaging Het
Stard9 A G 2: 120,700,630 E2456G probably damaging Het
Stx1b A T 7: 127,815,403 D16E probably benign Het
Tecpr2 T C 12: 110,915,453 V152A probably damaging Het
Tedc1 T C 12: 113,156,682 V47A probably benign Het
Tep1 A T 14: 50,868,317 L82Q probably damaging Het
Tgm4 A G 9: 123,056,494 Y367C probably damaging Het
Tle1 C T 4: 72,141,844 V258M probably damaging Het
Tm9sf1 C T 14: 55,642,844 G32D possibly damaging Het
Tmco2 A G 4: 121,105,984 L106P probably damaging Het
Tmem131 A T 1: 36,872,558 C103S possibly damaging Het
Tmprss7 T A 16: 45,669,528 I444F possibly damaging Het
Trank1 T C 9: 111,362,402 V493A probably benign Het
Trim80 A T 11: 115,448,017 T558S probably benign Het
Trmt6 C A 2: 132,808,783 A302S probably benign Het
Tulp4 T A 17: 6,236,293 V1532D probably damaging Het
Ubqlnl T G 7: 104,149,217 I358L probably benign Het
Ulk3 T A 9: 57,590,740 I108N possibly damaging Het
Vps13b A T 15: 35,640,528 probably null Het
Vwa3a A G 7: 120,790,142 K68E possibly damaging Het
Zfp746 G T 6: 48,064,176 H538N possibly damaging Het
Other mutations in Ttc17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Ttc17 APN 2 94323083 splice site probably benign
IGL00870:Ttc17 APN 2 94371733 splice site probably null
IGL01120:Ttc17 APN 2 94371796 missense probably damaging 1.00
IGL01845:Ttc17 APN 2 94332832 nonsense probably null
IGL01895:Ttc17 APN 2 94375146 missense possibly damaging 0.80
IGL02064:Ttc17 APN 2 94330667 missense probably damaging 1.00
IGL02296:Ttc17 APN 2 94377710 missense probably damaging 1.00
IGL02309:Ttc17 APN 2 94342661 missense probably benign
IGL02456:Ttc17 APN 2 94362785 splice site probably benign
IGL02475:Ttc17 APN 2 94364376 missense probably damaging 1.00
IGL03341:Ttc17 APN 2 94375221 missense probably damaging 1.00
IGL03371:Ttc17 APN 2 94386105 missense probably damaging 1.00
R0389:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0443:Ttc17 UTSW 2 94378094 missense probably benign 0.03
R0511:Ttc17 UTSW 2 94323120 missense possibly damaging 0.87
R0763:Ttc17 UTSW 2 94332803 missense probably benign 0.08
R1980:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1981:Ttc17 UTSW 2 94326704 missense possibly damaging 0.82
R1987:Ttc17 UTSW 2 94364345 missense probably benign
R2064:Ttc17 UTSW 2 94366547 missense probably damaging 1.00
R2147:Ttc17 UTSW 2 94301794 missense possibly damaging 0.87
R2155:Ttc17 UTSW 2 94366642 missense possibly damaging 0.88
R2844:Ttc17 UTSW 2 94376074 nonsense probably null
R3719:Ttc17 UTSW 2 94364327 missense probably benign 0.27
R3852:Ttc17 UTSW 2 94369413 missense possibly damaging 0.86
R3947:Ttc17 UTSW 2 94376146 splice site probably benign
R4411:Ttc17 UTSW 2 94342753 missense probably damaging 0.97
R4461:Ttc17 UTSW 2 94366571 missense probably benign 0.02
R4660:Ttc17 UTSW 2 94364429 missense possibly damaging 0.51
R4762:Ttc17 UTSW 2 94371768 missense probably damaging 1.00
R4818:Ttc17 UTSW 2 94332891 missense possibly damaging 0.91
R4819:Ttc17 UTSW 2 94364610 missense probably damaging 1.00
R4864:Ttc17 UTSW 2 94366635 missense probably benign 0.01
R4870:Ttc17 UTSW 2 94366609 missense probably damaging 1.00
R5203:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
R5288:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5385:Ttc17 UTSW 2 94303640 missense probably damaging 1.00
R5453:Ttc17 UTSW 2 94303560 missense probably damaging 1.00
R5583:Ttc17 UTSW 2 94377682 missense probably damaging 1.00
R5683:Ttc17 UTSW 2 94362521 missense probably damaging 1.00
R5921:Ttc17 UTSW 2 94378848 missense probably damaging 1.00
R6272:Ttc17 UTSW 2 94358755 missense probably damaging 1.00
R6444:Ttc17 UTSW 2 94303546 missense possibly damaging 0.57
R6748:Ttc17 UTSW 2 94386102 missense probably benign 0.02
R7204:Ttc17 UTSW 2 94362428 missense possibly damaging 0.95
R7300:Ttc17 UTSW 2 94375134 missense probably damaging 1.00
R7446:Ttc17 UTSW 2 94375150 missense probably damaging 0.97
R7680:Ttc17 UTSW 2 94366544 missense probably benign 0.06
R7912:Ttc17 UTSW 2 94378821 missense probably damaging 1.00
R8083:Ttc17 UTSW 2 94374564 missense probably damaging 1.00
X0013:Ttc17 UTSW 2 94330670 missense probably damaging 1.00
X0018:Ttc17 UTSW 2 94378716 missense probably damaging 1.00
X0025:Ttc17 UTSW 2 94324516 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAACTTTCTGTCTGTGTAGATGCTG -3'
(R):5'- ATGCTTCTCACGTAAGGCTTTGC -3'

Sequencing Primer
(F):5'- TGGAGATAACACTTTTGGGAAACTG -3'
(R):5'- GCTTTGCCAGTGGAAGGG -3'
Posted On2016-08-04