Incidental Mutation 'R5386:Ak2'
ID 425196
Institutional Source Beutler Lab
Gene Symbol Ak2
Ensembl Gene ENSMUSG00000028792
Gene Name adenylate kinase 2
Synonyms D4Ertd220e, Ak-2
Accession Numbers
Essential gene? Probably essential (E-score: 0.958) question?
Stock # R5386 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 128991958-129011529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 129008172 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 213 (S213P)
Ref Sequence ENSEMBL: ENSMUSP00000099664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030583] [ENSMUST00000102604] [ENSMUST00000152762]
AlphaFold Q9WTP6
Predicted Effect probably benign
Transcript: ENSMUST00000030583
AA Change: S213P

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030583
Gene: ENSMUSG00000028792
AA Change: S213P

DomainStartEndE-ValueType
Pfam:ADK 20 206 2.2e-62 PFAM
Pfam:ADK_lid 142 177 4.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102604
AA Change: S213P

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099664
Gene: ENSMUSG00000028792
AA Change: S213P

DomainStartEndE-ValueType
Pfam:ADK 20 206 2.3e-62 PFAM
Pfam:ADK_lid 142 177 9.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152762
SMART Domains Protein: ENSMUSP00000122284
Gene: ENSMUSG00000028792

DomainStartEndE-ValueType
Pfam:ADK 17 72 9.3e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 134 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 T G 8: 86,517,489 (GRCm38) K1012Q possibly damaging Het
Afmid G A 11: 117,828,142 (GRCm38) G33R probably benign Het
Agbl3 G T 6: 34,799,196 (GRCm38) W207C probably damaging Het
Ajuba T C 14: 54,570,398 (GRCm38) Y459C probably damaging Het
Alk T A 17: 71,875,012 (GRCm38) N1339Y probably damaging Het
Angpt1 T C 15: 42,438,365 (GRCm38) S416G probably damaging Het
Ank2 C T 3: 126,981,933 (GRCm38) V854M probably benign Het
Ankrd61 G T 5: 143,891,664 (GRCm38) N122K possibly damaging Het
Armc9 T A 1: 86,198,289 (GRCm38) L34Q probably null Het
Aspg T A 12: 112,123,032 (GRCm38) V418E probably benign Het
Baz1b C T 5: 135,238,059 (GRCm38) R1241C probably damaging Het
Bclaf1 T C 10: 20,325,592 (GRCm38) V201A possibly damaging Het
C1ql3 A T 2: 13,004,358 (GRCm38) D225E probably damaging Het
Capn9 A G 8: 124,605,540 (GRCm38) T417A possibly damaging Het
Card14 C T 11: 119,317,289 (GRCm38) R62C probably damaging Het
Cc2d2a A G 5: 43,730,041 (GRCm38) N1271S probably benign Het
Ccpg1 G A 9: 73,013,044 (GRCm38) S647N probably benign Het
Cdv3 T C 9: 103,355,230 (GRCm38) K133R possibly damaging Het
Cep128 A C 12: 90,999,571 (GRCm38) S1087R probably benign Het
Cep70 T A 9: 99,281,075 (GRCm38) L325Q probably damaging Het
Chit1 T G 1: 134,149,454 (GRCm38) F332V probably damaging Het
Chodl C A 16: 78,946,697 (GRCm38) T219K probably damaging Het
Cntn4 T C 6: 106,181,804 (GRCm38) L10P possibly damaging Het
Copg1 G T 6: 87,890,207 (GRCm38) M87I possibly damaging Het
Cplane1 G A 15: 8,194,413 (GRCm38) G887R probably damaging Het
Cyp3a59 A G 5: 146,085,768 (GRCm38) Y28C probably benign Het
Dchs1 A C 7: 105,758,029 (GRCm38) V2119G probably damaging Het
Dedd T C 1: 171,338,383 (GRCm38) L23P probably damaging Het
Dmxl2 A G 9: 54,378,757 (GRCm38) S2715P probably benign Het
Dnah9 T C 11: 66,029,356 (GRCm38) N2237S probably damaging Het
Drosha A G 15: 12,842,121 (GRCm38) I337V probably benign Het
Duox2 A G 2: 122,295,136 (GRCm38) V330A probably benign Het
Dusp11 T C 6: 85,947,605 (GRCm38) *322W probably null Het
Dusp8 T A 7: 142,089,993 (GRCm38) Q61L possibly damaging Het
Ears2 G C 7: 122,044,377 (GRCm38) T426S probably benign Het
Elmo1 T C 13: 20,600,210 (GRCm38) Y646H probably benign Het
Eps15 T A 4: 109,321,225 (GRCm38) I220K possibly damaging Het
Faap100 T A 11: 120,377,632 (GRCm38) E105V possibly damaging Het
Fam171a2 C A 11: 102,437,867 (GRCm38) V689L possibly damaging Het
Fam91a1 G A 15: 58,448,394 (GRCm38) S645N probably benign Het
Fancg G A 4: 43,007,076 (GRCm38) Q234* probably null Het
Garre1 A G 7: 34,242,388 (GRCm38) F120L probably damaging Het
Gid4 T A 11: 60,432,442 (GRCm38) probably null Het
Gm7361 A C 5: 26,258,905 (GRCm38) T53P probably benign Het
Golgb1 T A 16: 36,912,315 (GRCm38) C641* probably null Het
Gon4l T A 3: 88,858,496 (GRCm38) M409K probably benign Het
Gpatch8 A T 11: 102,508,227 (GRCm38) probably null Het
Gpr156 T A 16: 37,948,309 (GRCm38) V64E possibly damaging Het
Grid2 T A 6: 63,931,105 (GRCm38) I243K probably damaging Het
Gucy2g G A 19: 55,215,116 (GRCm38) A750V probably damaging Het
Hdac5 T C 11: 102,202,141 (GRCm38) E590G possibly damaging Het
Herc3 T A 6: 58,874,278 (GRCm38) M504K probably damaging Het
Hif1a A G 12: 73,944,093 (GRCm38) E713G probably benign Het
Hmx3 A G 7: 131,544,304 (GRCm38) D247G probably damaging Het
Hoxd11 G T 2: 74,682,819 (GRCm38) E143* probably null Het
Ifitm3 T C 7: 141,010,641 (GRCm38) N2S probably benign Het
Il17f T C 1: 20,777,957 (GRCm38) Q99R probably benign Het
Itga6 T A 2: 71,841,150 (GRCm38) S341R probably damaging Het
Itgam A G 7: 128,107,980 (GRCm38) N661S probably benign Het
Jag1 A T 2: 137,095,544 (GRCm38) H303Q possibly damaging Het
Kcnh8 T A 17: 52,725,995 (GRCm38) N103K probably benign Het
Kdm6b T C 11: 69,400,810 (GRCm38) probably benign Het
Keg1 A C 19: 12,714,538 (GRCm38) N63T probably damaging Het
Klf12 T A 14: 99,900,159 (GRCm38) H317L probably damaging Het
Lrp1 A T 10: 127,592,114 (GRCm38) V530E probably damaging Het
Mrgpra6 A G 7: 47,188,881 (GRCm38) C190R probably damaging Het
Myo1a G T 10: 127,705,897 (GRCm38) E102* probably null Het
Napa A T 7: 16,116,472 (GRCm38) E265D probably benign Het
Ncam1 A C 9: 49,564,874 (GRCm38) V305G probably damaging Het
Nek8 T C 11: 78,170,437 (GRCm38) probably null Het
Or10ag53 C T 2: 87,252,483 (GRCm38) P182L probably benign Het
Or11g24 T A 14: 50,425,389 (GRCm38) V290E possibly damaging Het
Or4a70 G T 2: 89,494,137 (GRCm38) Y58* probably null Het
Or4f52 T C 2: 111,231,194 (GRCm38) T200A probably benign Het
Or52a20 T C 7: 103,717,355 (GRCm38) F254L probably benign Het
Or5ak4 T C 2: 85,331,635 (GRCm38) T88A probably benign Het
Or5h23 T A 16: 59,085,890 (GRCm38) M198L probably benign Het
Or8c11 A T 9: 38,377,985 (GRCm38) I29F probably benign Het
Or8g2b A G 9: 39,839,830 (GRCm38) Y132C possibly damaging Het
Pabpc4 A G 4: 123,294,997 (GRCm38) Q417R probably benign Het
Panx3 A T 9: 37,669,024 (GRCm38) M11K probably damaging Het
Pcbp1 C T 6: 86,525,489 (GRCm38) E143K probably damaging Het
Pdcd7 G A 9: 65,358,692 (GRCm38) W477* probably null Het
Pi4k2a G A 19: 42,090,515 (GRCm38) S5N probably damaging Het
Plag1 T A 4: 3,904,075 (GRCm38) Q372L probably benign Het
Plce1 C A 19: 38,760,091 (GRCm38) N1755K probably damaging Het
Pld4 G T 12: 112,763,988 (GRCm38) E102* probably null Het
Pnlip A G 19: 58,679,607 (GRCm38) N345S probably benign Het
Ppm1e A T 11: 87,358,551 (GRCm38) L118Q possibly damaging Het
Prkra T G 2: 76,639,278 (GRCm38) T146P probably damaging Het
Prpf8 A G 11: 75,495,799 (GRCm38) D1038G probably damaging Het
Prss51 T A 14: 64,097,094 (GRCm38) V108E probably damaging Het
Prxl2b T A 4: 154,899,005 (GRCm38) M1L probably benign Het
Ptch1 A G 13: 63,545,043 (GRCm38) Y181H probably damaging Het
Reln A G 5: 22,039,529 (GRCm38) V817A probably benign Het
Rictor C A 15: 6,789,504 (GRCm38) Q1403K probably benign Het
Rims1 T A 1: 22,412,245 (GRCm38) I882F probably damaging Het
Rnf19a A G 15: 36,242,039 (GRCm38) V618A probably benign Het
Ryr1 A T 7: 29,117,416 (GRCm38) I65N probably damaging Het
S1pr2 T C 9: 20,967,594 (GRCm38) T313A probably benign Het
Serpine2 A T 1: 79,821,287 (GRCm38) Y83* probably null Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 (GRCm38) probably benign Het
Sgip1 T C 4: 102,915,059 (GRCm38) V215A probably benign Het
Sgsm3 T C 15: 81,007,999 (GRCm38) V256A probably benign Het
Shroom4 T A X: 6,585,469 (GRCm38) C894* probably null Het
Slc14a2 T A 18: 78,185,840 (GRCm38) D306V possibly damaging Het
Slc28a2b C A 2: 122,522,778 (GRCm38) L480I probably benign Het
Slc4a10 A T 2: 62,290,058 (GRCm38) E843V probably damaging Het
Smyd4 T A 11: 75,390,156 (GRCm38) C152S probably damaging Het
Snx10 T C 6: 51,575,972 (GRCm38) Y32H probably damaging Het
Sorl1 T C 9: 42,057,284 (GRCm38) T558A possibly damaging Het
Spata31d1b G A 13: 59,719,052 (GRCm38) C1338Y possibly damaging Het
Sppl2c T A 11: 104,187,301 (GRCm38) I309K possibly damaging Het
Stard9 A G 2: 120,700,630 (GRCm38) E2456G probably damaging Het
Stx1b A T 7: 127,815,403 (GRCm38) D16E probably benign Het
Tecpr2 T C 12: 110,915,453 (GRCm38) V152A probably damaging Het
Tedc1 T C 12: 113,156,682 (GRCm38) V47A probably benign Het
Tep1 A T 14: 50,868,317 (GRCm38) L82Q probably damaging Het
Tgm4 A G 9: 123,056,494 (GRCm38) Y367C probably damaging Het
Tle1 C T 4: 72,141,844 (GRCm38) V258M probably damaging Het
Tm9sf1 C T 14: 55,642,844 (GRCm38) G32D possibly damaging Het
Tmco2 A G 4: 121,105,984 (GRCm38) L106P probably damaging Het
Tmem131 A T 1: 36,872,558 (GRCm38) C103S possibly damaging Het
Tmprss7 T A 16: 45,669,528 (GRCm38) I444F possibly damaging Het
Trank1 T C 9: 111,362,402 (GRCm38) V493A probably benign Het
Trim80 A T 11: 115,448,017 (GRCm38) T558S probably benign Het
Trmt6 C A 2: 132,808,783 (GRCm38) A302S probably benign Het
Ttc17 A T 2: 94,303,640 (GRCm38) W1067R probably damaging Het
Tulp4 T A 17: 6,236,293 (GRCm38) V1532D probably damaging Het
Ubqlnl T G 7: 104,149,217 (GRCm38) I358L probably benign Het
Ulk3 T A 9: 57,590,740 (GRCm38) I108N possibly damaging Het
Vps13b A T 15: 35,640,528 (GRCm38) probably null Het
Vwa3a A G 7: 120,790,142 (GRCm38) K68E possibly damaging Het
Zfp746 G T 6: 48,064,176 (GRCm38) H538N possibly damaging Het
Other mutations in Ak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02279:Ak2 APN 4 128,999,237 (GRCm38) missense probably benign 0.01
IGL03068:Ak2 APN 4 129,008,026 (GRCm38) splice site probably benign
R0587:Ak2 UTSW 4 129,002,378 (GRCm38) missense probably damaging 1.00
R1464:Ak2 UTSW 4 129,002,359 (GRCm38) splice site probably benign
R1727:Ak2 UTSW 4 129,007,763 (GRCm38) missense probably damaging 1.00
R1878:Ak2 UTSW 4 129,002,167 (GRCm38) missense probably damaging 1.00
R2002:Ak2 UTSW 4 129,008,229 (GRCm38) missense probably benign 0.00
R2030:Ak2 UTSW 4 129,008,220 (GRCm38) missense probably benign 0.00
R2061:Ak2 UTSW 4 129,008,197 (GRCm38) missense probably damaging 0.99
R4570:Ak2 UTSW 4 129,002,167 (GRCm38) missense probably damaging 0.99
R5108:Ak2 UTSW 4 129,002,241 (GRCm38) missense probably damaging 0.98
R5667:Ak2 UTSW 4 129,008,247 (GRCm38) missense probably damaging 1.00
R5671:Ak2 UTSW 4 129,008,247 (GRCm38) missense probably damaging 1.00
R6190:Ak2 UTSW 4 128,999,183 (GRCm38) missense probably damaging 1.00
R6936:Ak2 UTSW 4 128,999,212 (GRCm38) missense probably damaging 1.00
R7584:Ak2 UTSW 4 128,999,212 (GRCm38) missense probably damaging 1.00
R9424:Ak2 UTSW 4 129,002,402 (GRCm38) missense possibly damaging 0.93
R9742:Ak2 UTSW 4 129,008,168 (GRCm38) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- CAGTTGGCTAGTCAGGAGAG -3'
(R):5'- GCTTTCTGAGAAAGGAAGTTCCC -3'

Sequencing Primer
(F):5'- CACTGAAGAGAACTTTGCTGAC -3'
(R):5'- TTTCTGAGAAAGGAAGTTCCCTCCAC -3'
Posted On 2016-08-04